Incidental Mutation 'R5272:Nectin3'
ID400447
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Namenectin cell adhesion molecule 3
Synonyms3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location46387706-46498525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46448476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 521 (V521A)
Ref Sequence ENSEMBL: ENSMUSP00000023334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052] [ENSMUST00000121245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023334
AA Change: V521A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023335
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096052
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121245
SMART Domains Protein: ENSMUSP00000113146
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46458853 missense probably benign 0.23
R0373:Nectin3 UTSW 16 46458187 missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46458820 missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46454679 nonsense probably null
R1251:Nectin3 UTSW 16 46463842 missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46448756 missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46448394 nonsense probably null
R2250:Nectin3 UTSW 16 46454736 missense probably benign 0.00
R2448:Nectin3 UTSW 16 46448515 unclassified probably null
R2483:Nectin3 UTSW 16 46395179 missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46448590 missense probably benign 0.15
R4709:Nectin3 UTSW 16 46463943 missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46448160 intron probably benign
R4884:Nectin3 UTSW 16 46448886 missense probably benign 0.01
R5051:Nectin3 UTSW 16 46448550 missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46448449 missense probably benign 0.03
R5365:Nectin3 UTSW 16 46464106 nonsense probably null
R5768:Nectin3 UTSW 16 46458817 missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46464145 missense probably benign 0.00
R6029:Nectin3 UTSW 16 46436400 missense probably benign 0.08
R6131:Nectin3 UTSW 16 46395152 missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46395150 missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46463982 missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46458124 missense probably benign 0.01
R6360:Nectin3 UTSW 16 46411109 missense probably benign 0.09
R6505:Nectin3 UTSW 16 46448821 missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46463842 missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46395143 missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46395121 missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46448396 missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46496742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCAGATACATTGAACCCAGG -3'
(R):5'- AGGATGAGCTGGATTCTTACCC -3'

Sequencing Primer
(F):5'- CAGATACATTGAACCCAGGTTTTAC -3'
(R):5'- TGGATTCTTACCCAGACAGTG -3'
Posted On2016-07-06