Incidental Mutation 'R5272:Ttc27'
ID400453
Institutional Source Beutler Lab
Gene Symbol Ttc27
Ensembl Gene ENSMUSG00000024078
Gene Nametetratricopeptide repeat domain 27
Synonyms2610511O17Rik
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location74717750-74863570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74742977 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 293 (V293I)
Ref Sequence ENSEMBL: ENSMUSP00000024882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024882]
Predicted Effect probably damaging
Transcript: ENSMUST00000024882
AA Change: V293I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024882
Gene: ENSMUSG00000024078
AA Change: V293I

DomainStartEndE-ValueType
TPR 531 564 7.34e-3 SMART
TPR 565 598 5.56e-3 SMART
TPR 599 632 3.81e-1 SMART
Blast:TPR 633 666 7e-15 BLAST
coiled coil region 817 847 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Ttc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ttc27 APN 17 74780816 missense probably damaging 1.00
IGL01508:Ttc27 APN 17 74835357 missense probably damaging 0.98
IGL02010:Ttc27 APN 17 74780911 splice site probably benign
IGL02189:Ttc27 APN 17 74729899 missense probably damaging 0.99
IGL02487:Ttc27 APN 17 74856554 missense probably damaging 1.00
IGL02745:Ttc27 APN 17 74739733 missense probably benign 0.37
IGL02816:Ttc27 APN 17 74747774 splice site probably benign
IGL03389:Ttc27 APN 17 74858033 missense probably benign 0.00
R0024:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R0511:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R0518:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0521:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0633:Ttc27 UTSW 17 74729977 missense probably benign 0.02
R1415:Ttc27 UTSW 17 74739672 missense probably benign
R1597:Ttc27 UTSW 17 74863407 missense possibly damaging 0.95
R1961:Ttc27 UTSW 17 74780856 missense probably damaging 0.99
R2038:Ttc27 UTSW 17 74856502 missense probably benign 0.00
R3012:Ttc27 UTSW 17 74840459 missense probably benign 0.17
R3619:Ttc27 UTSW 17 74751128 splice site probably null
R4155:Ttc27 UTSW 17 74840460 missense probably benign 0.09
R4272:Ttc27 UTSW 17 74840360 missense probably damaging 1.00
R4291:Ttc27 UTSW 17 74856479 missense probably damaging 1.00
R4557:Ttc27 UTSW 17 74829549 missense probably benign 0.00
R5068:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5069:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5070:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5074:Ttc27 UTSW 17 74747755 missense probably damaging 1.00
R5169:Ttc27 UTSW 17 74747695 nonsense probably null
R5203:Ttc27 UTSW 17 74777654 missense probably damaging 1.00
R6260:Ttc27 UTSW 17 74858091 missense probably damaging 0.99
R6797:Ttc27 UTSW 17 74729888 missense probably benign 0.28
R6830:Ttc27 UTSW 17 74856555 nonsense probably null
R6987:Ttc27 UTSW 17 74777741 critical splice donor site probably null
R7121:Ttc27 UTSW 17 74747715 missense probably benign 0.04
R7393:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R7543:Ttc27 UTSW 17 74717750 start gained probably benign
R7635:Ttc27 UTSW 17 74718715 missense probably benign 0.22
X0026:Ttc27 UTSW 17 74856437 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAATGGAGACTGAGAATCTCATGTC -3'
(R):5'- AACGCTTGTCCCCATTTTAGG -3'

Sequencing Primer
(F):5'- AACATCGTTAGGCCTCAGGTC -3'
(R):5'- TTAGGTAAAAATAAGCGACGTCACC -3'
Posted On2016-07-06