Incidental Mutation 'R5272:Pcdhb4'
ID400457
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission 042836-MU
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37307766 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 43 (Y43C)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056712
AA Change: Y43C

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: Y43C

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37308210 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37308711 missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 unclassified probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37308735 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37309314 missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37308500 missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37309239 missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37308169 missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37309275 missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37309452 missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37309549 missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37309614 missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37309240 missense probably damaging 1.00
Z1177:Pcdhb4 UTSW 18 37309913 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCATTAAAGCACGTGTGTGG -3'
(R):5'- TCAGTATGATCTGGAAGTGCAG -3'

Sequencing Primer
(F):5'- AGCACGTGTGTGGATTCTAACAC -3'
(R):5'- TGCAGCACACAGGGTTCTG -3'
Posted On2016-07-06