Incidental Mutation 'R5272:Galr1'
ID400461
Institutional Source Beutler Lab
Gene Symbol Galr1
Ensembl Gene ENSMUSG00000024553
Gene Namegalanin receptor 1
SynonymsGalnr1
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location82392496-82406777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82405636 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 172 (Y172F)
Ref Sequence ENSEMBL: ENSMUSP00000066381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065224]
Predicted Effect probably benign
Transcript: ENSMUST00000065224
AA Change: Y172F

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066381
Gene: ENSMUSG00000024553
AA Change: Y172F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 38 320 3e-8 PFAM
Pfam:7TM_GPCR_Srsx 44 317 1.5e-11 PFAM
Pfam:7tm_1 50 302 3.6e-56 PFAM
Pfam:7TM_GPCR_Srv 53 319 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Galr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Galr1 APN 18 82393817 missense probably damaging 1.00
IGL02047:Galr1 APN 18 82405993 missense probably damaging 1.00
IGL02985:Galr1 APN 18 82393730 missense probably benign 0.00
R0147:Galr1 UTSW 18 82405570 missense probably benign 0.01
R0148:Galr1 UTSW 18 82405570 missense probably benign 0.01
R0417:Galr1 UTSW 18 82405540 missense probably damaging 1.00
R1080:Galr1 UTSW 18 82405507 missense probably damaging 1.00
R1481:Galr1 UTSW 18 82405741 missense possibly damaging 0.82
R2422:Galr1 UTSW 18 82405923 missense probably damaging 1.00
R4896:Galr1 UTSW 18 82393940 missense probably damaging 1.00
R5219:Galr1 UTSW 18 82393985 missense probably damaging 1.00
R5506:Galr1 UTSW 18 82405864 missense possibly damaging 0.95
R5870:Galr1 UTSW 18 82406072 missense probably benign 0.00
R5900:Galr1 UTSW 18 82393857 missense probably damaging 1.00
R7229:Galr1 UTSW 18 82405664 missense probably damaging 1.00
R7408:Galr1 UTSW 18 82393865 missense probably damaging 1.00
R7897:Galr1 UTSW 18 82406131 missense probably benign 0.06
R7980:Galr1 UTSW 18 82406131 missense probably benign 0.06
Z1177:Galr1 UTSW 18 82405772 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAAGAGCTGCATAGGAGCCTG -3'
(R):5'- TTTCAGGCCACCGTGTATGC -3'

Sequencing Primer
(F):5'- TGCATAGGAGCCTGGCCAG -3'
(R):5'- ACCGTGTATGCACTGCC -3'
Posted On2016-07-06