Incidental Mutation 'R5238:Tiprl'
ID400468
Institutional Source Beutler Lab
Gene Symbol Tiprl
Ensembl Gene ENSMUSG00000040843
Gene NameTIP41, TOR signalling pathway regulator-like (S. cerevisiae)
Synonyms1810011K17Rik
MMRRC Submission 042809-MU
Accession Numbers

Genbank: NM_145513; MGI: 1915087

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5238 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165212286-165236996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165215768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 263 (V263A)
Ref Sequence ENSEMBL: ENSMUSP00000037514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043235] [ENSMUST00000192436]
Predicted Effect probably benign
Transcript: ENSMUST00000043235
AA Change: V263A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037514
Gene: ENSMUSG00000040843
AA Change: V263A

DomainStartEndE-ValueType
Pfam:TIP41 48 225 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192726
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A) (see PPP2CA; MIM 176915), PP4 (see PPP4C; MIM 602035), and PP6 (see PPP6C; MIM 612725) (McConnell et al., 2007 [PubMed 17384681]).[supplied by OMIM, Nov 2010]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,163,368 probably null Het
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Bclaf1 T G 10: 20,332,384 probably benign Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Col20a1 T C 2: 180,998,586 V512A probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dffa T G 4: 149,104,303 L18R probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Gm12185 G A 11: 48,908,217 T483I possibly damaging Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Kidins220 C A 12: 25,003,010 T433K probably benign Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Tiprl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Tiprl APN 1 165236746 missense probably damaging 1.00
3-1:Tiprl UTSW 1 165215828 missense possibly damaging 0.80
R0471:Tiprl UTSW 1 165222523 splice site probably null
R0647:Tiprl UTSW 1 165222523 splice site probably null
R1413:Tiprl UTSW 1 165215790 missense possibly damaging 0.71
R1536:Tiprl UTSW 1 165228406 missense probably benign 0.00
R4232:Tiprl UTSW 1 165222587 missense probably damaging 0.99
R4997:Tiprl UTSW 1 165220190 missense possibly damaging 0.53
R7972:Tiprl UTSW 1 165236974 unclassified probably benign
R8114:Tiprl UTSW 1 165228422 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTCTGGAGCAGGAACTTGAAAAC -3'
(R):5'- GTTTCAGAAATCGTGTGAGCC -3'

Sequencing Primer
(F):5'- ACAGGAGTTGTGTGGAACCTGC -3'
(R):5'- TCGTGTGAGCCATAACTGAG -3'
Posted On2016-07-06