Mutagenetix > Incidental Mutations

Incidental Mutation 'R5198:Adamtsl3'

400474

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

MMRRC Submission

042774-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5198 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 82611798 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 1647 (K1647Q)

Ref Sequence

ENSEMBL: ENSMUSP00000133637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172784] [ENSMUST00000173287] [ENSMUST00000173828]

Predicted Effect

unknown
Transcript: ENSMUST00000172784
AA Change: K8Q

SMART Domains

Protein: ENSMUSP00000134150
Gene: ENSMUSG00000070469
AA Change: K8Q

Domain	Start	End	E-Value	Type
Blast:TSP1	1	32	3e-16	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173287
AA Change: K1647Q

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: K1647Q

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000173828
AA Change: K721Q

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: K721Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Meta Mutation Damage Score

0.2706

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

98% (54/55)

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	G	A	2: 23,212,461	C121Y	probably damaging	Het
Abcc9	A	G	6: 142,626,000	V1121A	probably benign	Het
Adgrb1	A	T	15: 74,543,701	Q710L	probably null	Het
Alox12	T	C	11: 70,254,417	E110G	probably damaging	Het
Cep152	T	A	2: 125,587,624	M738L	probably benign	Het
Cma2	T	C	14: 55,972,075	V38A	probably benign	Het
Dlc1	C	T	8: 36,938,398	G79D	probably damaging	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
Dus3l	A	G	17: 56,769,574	I585V	probably benign	Het
Etl4	A	G	2: 20,713,387	Y313C	probably damaging	Het
Fbxw15	C	A	9: 109,558,174	S251I	probably benign	Het
Gata4	G	A	14: 63,200,451	S417L	probably benign	Het
Gdpd5	T	A	7: 99,438,308	Y60N	probably damaging	Het
Gm17669	T	C	18: 67,562,556	M57T	probably benign	Het
Gpr39	A	T	1: 125,677,436	I34F	probably benign	Het
Iffo2	T	A	4: 139,575,217	D90E	probably benign	Het
Il17c	A	G	8: 122,422,369	D84G	possibly damaging	Het
Itih3	T	C	14: 30,912,649	T134A	probably benign	Het
Lama2	G	A	10: 27,347,003	A429V	probably damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mug1	G	A	6: 121,874,562	R806H	probably damaging	Het
Naaa	G	A	5: 92,268,045	R65*	probably null	Het
Nacc2	C	T	2: 26,060,334	M463I	probably benign	Het
Nemf	A	G	12: 69,356,047	S72P	probably damaging	Het
Nudt7	G	A	8: 114,135,445		probably null	Het
Olfr1272	T	C	2: 90,296,393	Q156R	probably damaging	Het
Olfr625-ps1	T	C	7: 103,682,729	S4P	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pacs1	T	C	19: 5,139,297	D757G	probably benign	Het
Pkd2	A	C	5: 104,483,092	I461L	probably benign	Het
Pramel5	T	G	4: 144,273,494		probably benign	Het
Ptgdr	G	C	14: 44,858,843	F137L	probably damaging	Het
Pum1	T	A	4: 130,779,879	C1085*	probably null	Het
Rfx3	T	C	19: 27,830,776	D189G	probably damaging	Het
Rlf	T	A	4: 121,148,553	K1077*	probably null	Het
Slc25a30	C	A	14: 75,769,616	D147Y	probably benign	Het
Smap2	T	C	4: 121,016,787	E22G	possibly damaging	Het
Szt2	T	C	4: 118,388,322	T1098A	probably benign	Het
Tbcc	T	C	17: 46,890,862	F58S	probably damaging	Het
Tekt3	G	A	11: 63,070,308	R101H	probably damaging	Het
Vcan	T	A	13: 89,690,872	E2184D	probably damaging	Het
Vkorc1	T	C	7: 127,894,588	E18G	probably benign	Het
Vmn1r68	T	C	7: 10,527,796	H125R	probably benign	Het
Vmn2r63	C	A	7: 42,903,745	V696L	probably benign	Het
Wdr59	G	A	8: 111,481,988	H421Y	probably benign	Het
Xkr7	T	C	2: 153,054,953	Y576H	probably damaging	Het
Zfp112	T	C	7: 24,124,856	V83A	possibly damaging	Het
Zfp616	G	A	11: 74,083,510	V293I	probably benign	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0295:Adamtsl3	UTSW	7	82548005	critical splice donor site	probably null
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0845:Adamtsl3	UTSW	7	82575996	missense	probably damaging	1.00
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4842:Adamtsl3	UTSW	7	82528861	missense	probably damaging	1.00
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5244:Adamtsl3	UTSW	7	82598069	missense	probably benign	0.02
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5682:Adamtsl3	UTSW	7	82606550	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	splice site	probably null
R5946:Adamtsl3	UTSW	7	82576057	missense	probably damaging	0.98
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	splice site	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R8109:Adamtsl3	UTSW	7	82602279	missense	possibly damaging	0.94
R8125:Adamtsl3	UTSW	7	82450333	splice site	probably null
R8211:Adamtsl3	UTSW	7	82523163	missense	probably damaging	1.00
R8348:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8360:Adamtsl3	UTSW	7	82547979	missense	probably damaging	1.00
R8448:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAACAGTGGCATCTTCTCCC -3'
(R):5'- GAATCAATGCTGCAGCCCAC -3'

Sequencing Primer
(F):5'- AAACAGTGGCATCTTCTCCCATTTTG -3'
(R):5'- CAACCCCTCCCCTGGACAAG -3'

Posted On

2016-07-06