Incidental Mutation 'R5198:Olfr625-ps1'
ID400479
Institutional Source Beutler Lab
Gene Symbol Olfr625-ps1
Ensembl Gene ENSMUSG00000073943
Gene Nameolfactory receptor 625, pseudogene 1
SynonymsMOR31-15P, GA_x6K02T2PBJ9-6416276-6417237
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5198 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103682720-103683685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103682729 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 4 (S4P)
Ref Sequence ENSEMBL: ENSMUSP00000095797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098195] [ENSMUST00000190218]
Predicted Effect probably benign
Transcript: ENSMUST00000098195
AA Change: S4P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095797
Gene: ENSMUSG00000073943
AA Change: S4P

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 8.1e-110 PFAM
Pfam:7TM_GPCR_Srsx 41 225 3.6e-9 PFAM
Pfam:7tm_1 47 299 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190218
SMART Domains Protein: ENSMUSP00000140044
Gene: ENSMUSG00000073943

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 31 214 7e-8 PFAM
Pfam:7tm_1 37 289 2.8e-26 PFAM
Pfam:7tm_4 136 282 2.7e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Adgrb1 A T 15: 74,543,701 Q710L probably null Het
Alox12 T C 11: 70,254,417 E110G probably damaging Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gdpd5 T A 7: 99,438,308 Y60N probably damaging Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T C 19: 5,139,297 D757G probably benign Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rfx3 T C 19: 27,830,776 D189G probably damaging Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Zfp616 G A 11: 74,083,510 V293I probably benign Het
Other mutations in Olfr625-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02547:Olfr625-ps1 APN 7 103682766 missense probably benign 0.01
R1160:Olfr625-ps1 UTSW 7 103682861 missense possibly damaging 0.50
R1508:Olfr625-ps1 UTSW 7 103683471 missense possibly damaging 0.50
R1766:Olfr625-ps1 UTSW 7 103682861 missense possibly damaging 0.50
R1901:Olfr625-ps1 UTSW 7 103683543 missense probably damaging 0.98
R2116:Olfr625-ps1 UTSW 7 103683312 missense probably damaging 1.00
R4701:Olfr625-ps1 UTSW 7 103683062 missense probably damaging 1.00
R4995:Olfr625-ps1 UTSW 7 103683367 missense probably damaging 1.00
R5750:Olfr625-ps1 UTSW 7 103683155 missense possibly damaging 0.95
R5776:Olfr625-ps1 UTSW 7 103683039 missense probably damaging 1.00
R5905:Olfr625-ps1 UTSW 7 103683574 missense probably damaging 1.00
R5933:Olfr625-ps1 UTSW 7 103683473 missense probably damaging 1.00
R6488:Olfr625-ps1 UTSW 7 103683078 missense probably damaging 0.98
R7846:Olfr625-ps1 UTSW 7 103683200 missense probably benign 0.03
R7878:Olfr625-ps1 UTSW 7 103683264 missense probably damaging 1.00
R7929:Olfr625-ps1 UTSW 7 103683200 missense probably benign 0.03
R7961:Olfr625-ps1 UTSW 7 103683264 missense probably damaging 1.00
RF040:Olfr625-ps1 UTSW 7 103682938 frame shift probably null
Z1088:Olfr625-ps1 UTSW 7 103683186 missense probably benign 0.01
Z1176:Olfr625-ps1 UTSW 7 103683105 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAAAGCCTACCAGAGACTCTG -3'
(R):5'- AGATATCAGCAAGTGCCAACATAG -3'

Sequencing Primer
(F):5'- GCCAACTGTGAGTATCAC -3'
(R):5'- GGTTCATGAAGGCTGCATTCAG -3'
Posted On2016-07-06