Incidental Mutation 'R5238:Dffa'
ID400484
Institutional Source Beutler Lab
Gene Symbol Dffa
Ensembl Gene ENSMUSG00000028974
Gene NameDNA fragmentation factor, alpha subunit
SynonymsICAD-L, A330085O09Rik, ICAD-S, DFF35, Dff45
MMRRC Submission 042809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5238 (G1)
Quality Score130
Status Not validated
Chromosome4
Chromosomal Location149104146-149120647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 149104303 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 18 (L18R)
Ref Sequence ENSEMBL: ENSMUSP00000099505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030816] [ENSMUST00000103216] [ENSMUST00000103217] [ENSMUST00000134747]
Predicted Effect probably benign
Transcript: ENSMUST00000030816
AA Change: L18R

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030816
Gene: ENSMUSG00000028974
AA Change: L18R

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103216
AA Change: L18R

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099505
Gene: ENSMUSG00000028974
AA Change: L18R

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 2.2e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103217
SMART Domains Protein: ENSMUSP00000099506
Gene: ENSMUSG00000028975

DomainStartEndE-ValueType
Pfam:Pex14_N 25 135 9.8e-25 PFAM
coiled coil region 163 198 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 316 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128067
Predicted Effect probably benign
Transcript: ENSMUST00000134747
SMART Domains Protein: ENSMUSP00000116791
Gene: ENSMUSG00000028975

DomainStartEndE-ValueType
Pfam:Pex14_N 25 66 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show increased resistance to apoptosis in response to several apoptotic stimuli, enhanced spatial learning and memory, higher granule cell density and total granule cell number in the dentate gyrus, and resistance to kainic acid-induced CA3 neuronal cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,163,368 probably null Het
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Bclaf1 T G 10: 20,332,384 probably benign Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Col20a1 T C 2: 180,998,586 V512A probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Gm12185 G A 11: 48,908,217 T483I possibly damaging Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Kidins220 C A 12: 25,003,010 T433K probably benign Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tiprl A G 1: 165,215,768 V263A probably benign Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Dffa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1475:Dffa UTSW 4 149117478 missense probably damaging 1.00
R1672:Dffa UTSW 4 149106245 missense probably damaging 1.00
R1950:Dffa UTSW 4 149104382 missense probably benign 0.05
R3856:Dffa UTSW 4 149104251 start codon destroyed possibly damaging 0.62
R5185:Dffa UTSW 4 149117430 missense probably benign 0.04
R5280:Dffa UTSW 4 149117934 missense probably benign 0.00
R5514:Dffa UTSW 4 149106315 critical splice donor site probably null
X0065:Dffa UTSW 4 149119131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTAGCCGCCACTAGAAC -3'
(R):5'- CGCCAGGAATCTGTCAATCAC -3'

Sequencing Primer
(F):5'- TAGAACTACATCTCCCGGCGTG -3'
(R):5'- GGAATCTGTCAATCACTGGACC -3'
Posted On2016-07-06