Incidental Mutation 'R5198:Alox12'
ID400499
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Namearachidonate 12-lipoxygenase
SynonymsP-12LO, 9930022G08Rik, Alox12p
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5198 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70241457-70255353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70254417 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 110 (E110G)
Ref Sequence ENSEMBL: ENSMUSP00000000329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000108574]
Predicted Effect probably damaging
Transcript: ENSMUST00000000329
AA Change: E110G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320
AA Change: E110G

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108574
AA Change: E110G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104214
Gene: ENSMUSG00000000320
AA Change: E110G

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 121 211 8.1e-9 PFAM
Pfam:Lipoxygenase 210 390 3e-61 PFAM
Meta Mutation Damage Score 0.2631 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Adgrb1 A T 15: 74,543,701 Q710L probably null Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gdpd5 T A 7: 99,438,308 Y60N probably damaging Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Olfr625-ps1 T C 7: 103,682,729 S4P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T C 19: 5,139,297 D757G probably benign Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rfx3 T C 19: 27,830,776 D189G probably damaging Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Zfp616 G A 11: 74,083,510 V293I probably benign Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70254549 missense probably benign 0.12
IGL01629:Alox12 APN 11 70242834 missense probably damaging 1.00
IGL02657:Alox12 APN 11 70247278 missense probably benign
IGL02966:Alox12 APN 11 70250085 missense probably damaging 1.00
R0243:Alox12 UTSW 11 70242716 missense possibly damaging 0.82
R0357:Alox12 UTSW 11 70242536 missense probably damaging 1.00
R0394:Alox12 UTSW 11 70245935 missense probably damaging 1.00
R0422:Alox12 UTSW 11 70254558 missense probably damaging 1.00
R0564:Alox12 UTSW 11 70252836 missense probably damaging 0.99
R0751:Alox12 UTSW 11 70246950 missense probably benign 0.00
R1539:Alox12 UTSW 11 70253243 splice site probably null
R1562:Alox12 UTSW 11 70250165 missense probably damaging 0.97
R2165:Alox12 UTSW 11 70242572 splice site probably null
R2295:Alox12 UTSW 11 70242465 missense probably benign 0.45
R4073:Alox12 UTSW 11 70247310 missense probably damaging 1.00
R4558:Alox12 UTSW 11 70253063 missense probably benign 0.03
R5081:Alox12 UTSW 11 70255314 splice site probably null
R5507:Alox12 UTSW 11 70254412 missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70243053 missense probably benign 0.00
R5832:Alox12 UTSW 11 70253280 missense probably damaging 0.98
R5975:Alox12 UTSW 11 70242783 missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70247055 missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70251587 missense probably benign 0.05
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70253110 missense probably damaging 1.00
R6505:Alox12 UTSW 11 70250204 missense probably damaging 1.00
R7320:Alox12 UTSW 11 70254472 missense probably benign 0.02
R7595:Alox12 UTSW 11 70242404 missense probably damaging 1.00
R7972:Alox12 UTSW 11 70242687 missense probably benign 0.15
X0025:Alox12 UTSW 11 70255224 missense probably damaging 0.96
Z1177:Alox12 UTSW 11 70251479 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCACTTATCCTGGGAAACACTTG -3'
(R):5'- TTTGACTTCGACGTTCCCGAG -3'

Sequencing Primer
(F):5'- TATCCTGGGAAACACTTGGGGAATTC -3'
(R):5'- TTCGACGTTCCCGAGGACTTG -3'
Posted On2016-07-06