Incidental Mutation 'R0456:Rgl2'
ID 40050
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 038656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R0456 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 34155823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174426] [ENSMUST00000174048] [ENSMUST00000179418]
AlphaFold Q61193
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably null
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,429,036 (GRCm39) P11L probably damaging Het
Antxr1 A C 6: 87,194,257 (GRCm39) V347G probably damaging Het
Atp13a5 T C 16: 29,051,492 (GRCm39) N1127D probably benign Het
Bivm T A 1: 44,165,969 (GRCm39) W140R probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ceacam5 T C 7: 17,494,776 (GRCm39) V928A possibly damaging Het
Chia1 T C 3: 106,035,795 (GRCm39) Y152H probably damaging Het
Chsy3 A T 18: 59,309,550 (GRCm39) I268F probably damaging Het
CK137956 A T 4: 127,839,100 (GRCm39) N439K probably damaging Het
Csf3r C A 4: 125,929,654 (GRCm39) N392K probably damaging Het
Cyp1b1 T C 17: 80,017,704 (GRCm39) I484V probably benign Het
Dsc1 T C 18: 20,232,169 (GRCm39) K280E probably damaging Het
Eefsec A G 6: 88,274,870 (GRCm39) Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 (GRCm39) probably null Het
Erap1 G A 13: 74,812,339 (GRCm39) V385I probably benign Het
Fat1 A T 8: 45,482,571 (GRCm39) I3077F probably damaging Het
Fras1 T G 5: 96,862,202 (GRCm39) probably null Het
Fras1 G T 5: 96,702,647 (GRCm39) G230C probably damaging Het
Gsg1l A G 7: 125,522,682 (GRCm39) M182T possibly damaging Het
Gzmg A G 14: 56,395,779 (GRCm39) V60A probably damaging Het
H4c6 T C 13: 23,735,561 (GRCm39) D86G probably damaging Het
Hapln4 A T 8: 70,537,645 (GRCm39) Y113F probably benign Het
Ikzf4 T A 10: 128,471,677 (GRCm39) T274S probably damaging Het
Kansl1l T A 1: 66,774,885 (GRCm39) H302L probably damaging Het
Klhl41 T C 2: 69,500,893 (GRCm39) V118A probably damaging Het
Kpna1 T C 16: 35,823,270 (GRCm39) S41P possibly damaging Het
Krt23 A G 11: 99,377,604 (GRCm39) V134A probably benign Het
Lamb1 G A 12: 31,354,729 (GRCm39) C992Y probably damaging Het
Lrif1 C T 3: 106,639,094 (GRCm39) P35S probably benign Het
Lrrc4 A G 6: 28,831,103 (GRCm39) S171P probably damaging Het
Lvrn G A 18: 46,997,883 (GRCm39) probably null Het
Matr3 T A 18: 35,705,917 (GRCm39) F281I probably damaging Het
Meak7 A T 8: 120,495,162 (GRCm39) F199I probably damaging Het
Nxn G A 11: 76,153,963 (GRCm39) Q291* probably null Het
Or5b113 A G 19: 13,342,102 (GRCm39) T37A probably damaging Het
Pdp2 G T 8: 105,320,421 (GRCm39) R90L probably damaging Het
Ppp1r3c C A 19: 36,711,291 (GRCm39) E160* probably null Het
Ppp2r5c T G 12: 110,489,013 (GRCm39) S118R probably damaging Het
Ptpn23 G T 9: 110,218,861 (GRCm39) probably null Het
Ptpro G T 6: 137,391,228 (GRCm39) V783L probably benign Het
Rab40c A G 17: 26,103,631 (GRCm39) V144A possibly damaging Het
Rasal2 T C 1: 156,977,413 (GRCm39) N1087S probably damaging Het
Rfc3 T A 5: 151,570,988 (GRCm39) S103C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rit2 A T 18: 31,108,504 (GRCm39) F160L probably benign Het
Rnh1 A G 7: 140,742,461 (GRCm39) S366P possibly damaging Het
Sdk2 T C 11: 113,682,292 (GRCm39) Y2029C possibly damaging Het
Smpd3 T A 8: 106,986,288 (GRCm39) I505F probably benign Het
Sorcs3 A T 19: 48,642,483 (GRCm39) S379C possibly damaging Het
Sult1e1 A G 5: 87,726,493 (GRCm39) L207P possibly damaging Het
Sycp2 C G 2: 178,023,648 (GRCm39) S456T probably benign Het
Syne1 T C 10: 5,292,252 (GRCm39) T1339A probably benign Het
Tas2r117 A G 6: 132,780,354 (GRCm39) N164S probably benign Het
Tigd3 A G 19: 5,942,821 (GRCm39) L103P probably damaging Het
Tmem132b T C 5: 125,864,788 (GRCm39) S965P probably damaging Het
Tmem82 T C 4: 141,344,701 (GRCm39) T81A probably benign Het
Tmem8b A G 4: 43,685,618 (GRCm39) T156A probably benign Het
Tnfrsf21 A G 17: 43,348,982 (GRCm39) E198G probably benign Het
Tnpo2 A G 8: 85,781,045 (GRCm39) N767S probably damaging Het
Trf T C 9: 103,104,102 (GRCm39) Y87C probably damaging Het
Tst A G 15: 78,289,780 (GRCm39) V85A probably damaging Het
Usp37 A T 1: 74,507,507 (GRCm39) N503K probably damaging Het
Utp20 C T 10: 88,590,435 (GRCm39) M2346I possibly damaging Het
Vax2 A G 6: 83,688,388 (GRCm39) D37G probably benign Het
Vmn1r77 T A 7: 11,775,665 (GRCm39) L79* probably null Het
Zbtb3 A T 19: 8,780,564 (GRCm39) D59V probably damaging Het
Zdhhc13 T C 7: 48,458,602 (GRCm39) F182S probably benign Het
Zfp426 A G 9: 20,381,593 (GRCm39) F465L probably damaging Het
Zfp526 A G 7: 24,925,637 (GRCm39) E632G probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGCAGCCACTATATTGGGTTTC -3'
(R):5'- TCAGCTCTGTGGGTTCAGAAGAGG -3'

Sequencing Primer
(F):5'- atctgcctgcctctgcc -3'
(R):5'- GATTAGCGTTCGGCCCTC -3'
Posted On 2013-05-23