Mutagenetix > Incidental Mutation

Incidental Mutation 'R5238:Trpm1'

400506

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, melastatin, 4732499L03Rik, LTRPC1

MMRRC Submission

042809-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5238 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63803583-63919523 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63918702 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 681 (F681I)

Ref Sequence

ENSEMBL: ENSMUSP00000145593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: F1565I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: F1565I

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107519
AA Change: F1449I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: F1449I

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
low complexity region	505	534	N/A	INTRINSIC
low complexity region	707	719	N/A	INTRINSIC
transmembrane domain	760	779	N/A	INTRINSIC
Pfam:Ion_trans	791	1004	1.3e-15	PFAM
transmembrane domain	1034	1051	N/A	INTRINSIC
low complexity region	1100	1109	N/A	INTRINSIC
PDB:3E7K\|H	1112	1163	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: F1449I

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: F1571I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206314
AA Change: F681I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd12b	T	A	12: 70,210,142 (GRCm39)		probably null	Het
Adamtsl5	C	T	10: 80,181,192 (GRCm39)	G63D	probably damaging	Het
Armc9	T	A	1: 86,127,569 (GRCm39)	M68K	probably benign	Het
Atad2	A	C	15: 57,971,733 (GRCm39)	H381Q	possibly damaging	Het
Bclaf1	T	G	10: 20,208,130 (GRCm39)		probably benign	Het
Ccdc188	A	G	16: 18,037,038 (GRCm39)	E238G	probably damaging	Het
Cldn19	G	T	4: 119,112,930 (GRCm39)	C54F	probably damaging	Het
Clip1	T	C	5: 123,785,946 (GRCm39)	D246G	probably damaging	Het
Col20a1	T	C	2: 180,640,379 (GRCm39)	V512A	probably damaging	Het
Cyfip1	G	T	7: 55,541,779 (GRCm39)	A355S	probably benign	Het
Dffa	T	G	4: 149,188,760 (GRCm39)	L18R	probably benign	Het
Dnah8	G	A	17: 31,009,891 (GRCm39)	E3761K	probably damaging	Het
Dusp10	A	G	1: 183,769,210 (GRCm39)	T59A	possibly damaging	Het
Eed	T	C	7: 89,626,173 (GRCm39)	S67G	probably benign	Het
Fam181a	C	T	12: 103,282,392 (GRCm39)	A99V	probably benign	Het
Gm12185	G	A	11: 48,799,044 (GRCm39)	T483I	possibly damaging	Het
Htr3b	A	T	9: 48,848,542 (GRCm39)	C234*	probably null	Het
Kidins220	C	A	12: 25,053,009 (GRCm39)	T433K	probably benign	Het
Man2a1	T	C	17: 64,943,502 (GRCm39)	Y186H	probably damaging	Het
Mcm9	G	T	10: 53,506,093 (GRCm39)	S60R	possibly damaging	Het
Mst1r	T	A	9: 107,784,773 (GRCm39)	C144S	probably damaging	Het
Nckap5	A	G	1: 125,955,461 (GRCm39)	C364R	probably damaging	Het
Nptx2	T	C	5: 144,493,041 (GRCm39)	I376T	probably damaging	Het
Or2a14	T	C	6: 43,130,961 (GRCm39)	S241P	probably damaging	Het
Otogl	A	T	10: 107,604,834 (GRCm39)	C2191S	probably damaging	Het
Plxdc2	T	A	2: 16,655,026 (GRCm39)	F208L	probably damaging	Het
Robo3	A	C	9: 37,328,175 (GRCm39)	Y1339D	probably damaging	Het
Rsph9	G	T	17: 46,446,008 (GRCm39)	Y42*	probably null	Het
Slc39a1	T	A	3: 90,156,702 (GRCm39)	L86Q	probably null	Het
Slfn8	T	C	11: 82,904,214 (GRCm39)	D392G	probably damaging	Het
Tiprl	A	G	1: 165,043,337 (GRCm39)	V263A	probably benign	Het
Tmub2	A	G	11: 102,175,820 (GRCm39)		probably benign	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Uba3	A	T	6: 97,178,896 (GRCm39)	C68*	probably null	Het
Vmn1r158	T	A	7: 22,489,799 (GRCm39)	M137L	probably benign	Het
Vmn1r50	C	T	6: 90,084,465 (GRCm39)	A70V	possibly damaging	Het
Wwc1	T	C	11: 35,766,723 (GRCm39)	K511E	probably benign	Het
Zfp600	T	C	4: 146,131,741 (GRCm39)		probably null	Het
Zng1	G	T	19: 24,897,994 (GRCm39)	T382K	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	63,893,198 (GRCm39)	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	63,897,215 (GRCm39)	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	63,885,572 (GRCm39)	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	63,893,312 (GRCm39)	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	63,860,578 (GRCm39)	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	63,884,767 (GRCm39)	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	63,854,276 (GRCm39)	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	63,893,329 (GRCm39)	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	63,918,637 (GRCm39)	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	63,876,645 (GRCm39)	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	63,884,742 (GRCm39)	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	63,858,723 (GRCm39)	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	63,860,613 (GRCm39)	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	63,867,362 (GRCm39)	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	63,884,800 (GRCm39)	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	63,895,690 (GRCm39)	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	63,868,869 (GRCm39)	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	63,890,175 (GRCm39)	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	63,918,862 (GRCm39)	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	63,848,972 (GRCm39)	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	63,868,881 (GRCm39)	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	63,868,908 (GRCm39)	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	63,918,309 (GRCm39)	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	63,848,998 (GRCm39)	intron	probably benign
R0012:Trpm1	UTSW	7	63,918,339 (GRCm39)	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	63,897,970 (GRCm39)	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	63,893,334 (GRCm39)	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	63,894,590 (GRCm39)	unclassified	probably benign
R0463:Trpm1	UTSW	7	63,870,002 (GRCm39)	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	63,852,801 (GRCm39)	splice site	probably null
R1397:Trpm1	UTSW	7	63,867,406 (GRCm39)	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	63,873,565 (GRCm39)	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	63,890,283 (GRCm39)	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	63,885,569 (GRCm39)	nonsense	probably null
R1827:Trpm1	UTSW	7	63,884,755 (GRCm39)	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	63,876,530 (GRCm39)	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	63,880,016 (GRCm39)	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	63,917,764 (GRCm39)	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	63,858,182 (GRCm39)	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	63,858,780 (GRCm39)	intron	probably null
R2054:Trpm1	UTSW	7	63,890,303 (GRCm39)	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	63,884,736 (GRCm39)	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	63,859,724 (GRCm39)	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	63,918,849 (GRCm39)	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	63,884,760 (GRCm39)	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	63,849,061 (GRCm39)	nonsense	probably null
R3615:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	63,867,475 (GRCm39)	intron	probably benign
R3822:Trpm1	UTSW	7	63,867,451 (GRCm39)	intron	probably benign
R4441:Trpm1	UTSW	7	63,851,666 (GRCm39)	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	63,858,660 (GRCm39)	nonsense	probably null
R4666:Trpm1	UTSW	7	63,852,782 (GRCm39)	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	63,893,248 (GRCm39)	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	63,884,800 (GRCm39)	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	63,858,054 (GRCm39)	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	63,894,580 (GRCm39)	unclassified	probably benign
R5030:Trpm1	UTSW	7	63,885,579 (GRCm39)	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	63,887,441 (GRCm39)	missense	possibly damaging	0.84
R5304:Trpm1	UTSW	7	63,858,694 (GRCm39)	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	63,870,018 (GRCm39)	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	63,858,159 (GRCm39)	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	63,918,710 (GRCm39)	nonsense	probably null
R5947:Trpm1	UTSW	7	63,873,547 (GRCm39)	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	63,876,553 (GRCm39)	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	63,918,450 (GRCm39)	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	63,917,724 (GRCm39)	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	63,918,226 (GRCm39)	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	63,848,942 (GRCm39)	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	63,918,252 (GRCm39)	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	63,803,781 (GRCm39)	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	63,890,343 (GRCm39)	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	63,893,181 (GRCm39)	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	63,876,462 (GRCm39)	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	63,885,593 (GRCm39)	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	63,918,445 (GRCm39)	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	63,854,333 (GRCm39)	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	63,868,854 (GRCm39)	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	63,859,729 (GRCm39)	nonsense	probably null
R7367:Trpm1	UTSW	7	63,918,549 (GRCm39)	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	63,858,723 (GRCm39)	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	63,890,330 (GRCm39)	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	63,858,657 (GRCm39)	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	63,854,303 (GRCm39)	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	63,897,939 (GRCm39)	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	63,851,689 (GRCm39)	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	63,858,718 (GRCm39)	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	63,849,017 (GRCm39)	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	63,851,699 (GRCm39)	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	63,918,541 (GRCm39)	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	63,897,155 (GRCm39)	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	63,874,356 (GRCm39)	splice site	probably null
R8813:Trpm1	UTSW	7	63,851,756 (GRCm39)	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	63,918,628 (GRCm39)	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	63,858,089 (GRCm39)	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	63,848,943 (GRCm39)	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	63,890,319 (GRCm39)	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	63,884,713 (GRCm39)	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	63,873,623 (GRCm39)	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	63,918,480 (GRCm39)	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	63,873,446 (GRCm39)	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	63,803,616 (GRCm39)	unclassified	probably benign
R9616:Trpm1	UTSW	7	63,858,132 (GRCm39)	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	63,898,041 (GRCm39)	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	63,918,658 (GRCm39)	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	63,854,342 (GRCm39)	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	63,852,879 (GRCm39)	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	63,867,439 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGTTCAATCATGGACCAAGCATG -3'
(R):5'- CATCAGCACTCAGTTTCCGC -3'

Sequencing Primer
(F):5'- TGTCAAGTTCAAAGGATCACGC -3'
(R):5'- GCACTCAGTTTCCGCGCTTC -3'

Posted On

2016-07-06