Incidental Mutation 'R0456:Tnfrsf21'
ID40051
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0456 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43038091 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 198 (E198G)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: E198G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: E198G

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Dsc1 T C 18: 20,099,112 K280E probably damaging Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lrrc4 A G 6: 28,831,104 S171P probably damaging Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Nxn G A 11: 76,263,137 Q291* probably null Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp1r3c C A 19: 36,733,891 E160* probably null Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Sdk2 T C 11: 113,791,466 Y2029C possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sult1e1 A G 5: 87,578,634 L207P possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATTACCTTGTGCTGCCTTGACTG -3'
(R):5'- GCCTTCCTCAAGCAAGCAATTCG -3'

Sequencing Primer
(F):5'- TTGACTGACCGAGAGTGCATC -3'
(R):5'- CAAGCAATTCGTGGGGTTGAG -3'
Posted On2013-05-23