Incidental Mutation 'R5198:Adgrb1'
ID400518
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5198 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74543701 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 710 (Q710L)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
Predicted Effect probably null
Transcript: ENSMUST00000042035
AA Change: Q710L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: Q710L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186360
AA Change: Q710L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: Q710L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.2534 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Alox12 T C 11: 70,254,417 E110G probably damaging Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gdpd5 T A 7: 99,438,308 Y60N probably damaging Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Olfr625-ps1 T C 7: 103,682,729 S4P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T C 19: 5,139,297 D757G probably benign Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rfx3 T C 19: 27,830,776 D189G probably damaging Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Zfp616 G A 11: 74,083,510 V293I probably benign Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
Bunting UTSW 15 74543701 missense probably null 0.94
PIT4520001:Adgrb1 UTSW 15 74541659 missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74529901 missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74574110 missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74569881 missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74569948 missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74569884 missense probably benign
R7283:Adgrb1 UTSW 15 74580663 missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74539245 missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74548569 missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74543638 missense possibly damaging 0.95
Z1177:Adgrb1 UTSW 15 74541676 missense probably damaging 1.00
Z1177:Adgrb1 UTSW 15 74547683 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGGAACCTCCATGCATTG -3'
(R):5'- CGGGATTCAGTGTGTGACCATG -3'

Sequencing Primer
(F):5'- CATGCATTGGAGGTCCCTG -3'
(R):5'- CAGTGTGTGACCATGTTTAAAGC -3'
Posted On2016-07-06