Incidental Mutation 'R5238:Gm12185'
ID400524
Institutional Source Beutler Lab
Gene Symbol Gm12185
Ensembl Gene ENSMUSG00000048852
Gene Namepredicted gene 12185
Synonyms
MMRRC Submission 042809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5238 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48904656-48992226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48908217 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 483 (T483I)
Ref Sequence ENSEMBL: ENSMUSP00000092049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059930
AA Change: T483I

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: T483I

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094476
AA Change: T483I

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: T483I

DomainStartEndE-ValueType
Pfam:IIGP 27 389 1e-122 PFAM
Pfam:DLIC 43 98 3.2e-5 PFAM
Pfam:MMR_HSR1 63 187 6e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 8.9e-153 PFAM
Pfam:MMR_HSR1 474 615 2.6e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,163,368 probably null Het
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Bclaf1 T G 10: 20,332,384 probably benign Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Col20a1 T C 2: 180,998,586 V512A probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dffa T G 4: 149,104,303 L18R probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Kidins220 C A 12: 25,003,010 T433K probably benign Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tiprl A G 1: 165,215,768 V263A probably benign Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Gm12185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gm12185 APN 11 48907222 missense probably benign 0.01
IGL00495:Gm12185 APN 11 48907861 missense probably damaging 0.99
IGL01763:Gm12185 APN 11 48915844 missense probably benign 0.07
IGL01919:Gm12185 APN 11 48908059 missense possibly damaging 0.90
IGL03388:Gm12185 APN 11 48908286 missense probably benign 0.01
IGL03404:Gm12185 APN 11 48908037 missense probably damaging 1.00
PIT4458001:Gm12185 UTSW 11 48907911 missense probably damaging 1.00
R0347:Gm12185 UTSW 11 48915182 missense probably benign 0.29
R0488:Gm12185 UTSW 11 48907839 missense probably damaging 1.00
R1168:Gm12185 UTSW 11 48915355 missense possibly damaging 0.60
R1223:Gm12185 UTSW 11 48907276 missense probably damaging 0.98
R1417:Gm12185 UTSW 11 48907842 missense probably damaging 1.00
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1519:Gm12185 UTSW 11 48907767 missense probably damaging 1.00
R1558:Gm12185 UTSW 11 48915435 missense probably damaging 0.99
R1630:Gm12185 UTSW 11 48907890 missense probably benign 0.31
R1758:Gm12185 UTSW 11 48908032 missense possibly damaging 0.82
R1793:Gm12185 UTSW 11 48915756 nonsense probably null
R1908:Gm12185 UTSW 11 48915404 missense probably benign 0.00
R1983:Gm12185 UTSW 11 48915356 missense probably benign 0.01
R3917:Gm12185 UTSW 11 48915933 missense probably benign 0.01
R3969:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R3970:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R4510:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4511:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4529:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4529:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4532:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4532:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4533:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4533:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4678:Gm12185 UTSW 11 48915540 missense probably benign 0.05
R5094:Gm12185 UTSW 11 48907548 missense probably benign 0.35
R5306:Gm12185 UTSW 11 48915555 missense probably benign 0.03
R5371:Gm12185 UTSW 11 48915739 missense probably benign 0.01
R5995:Gm12185 UTSW 11 48915713 missense probably benign 0.40
R6113:Gm12185 UTSW 11 48915340 missense possibly damaging 0.47
R6147:Gm12185 UTSW 11 48915890 missense probably benign
R6160:Gm12185 UTSW 11 48908428 nonsense probably null
R6247:Gm12185 UTSW 11 48915908 missense probably damaging 0.98
R6264:Gm12185 UTSW 11 48916175 missense probably benign 0.01
R6748:Gm12185 UTSW 11 48916296 missense possibly damaging 0.53
R6765:Gm12185 UTSW 11 48915704 missense probably benign 0.12
R6970:Gm12185 UTSW 11 48907912 nonsense probably null
R7028:Gm12185 UTSW 11 48908244 missense possibly damaging 0.80
R7033:Gm12185 UTSW 11 48915999 missense probably benign
R7512:Gm12185 UTSW 11 48915890 missense probably benign
R7609:Gm12185 UTSW 11 48916023 missense possibly damaging 0.82
R7673:Gm12185 UTSW 11 48907628 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GCTTTGGCCAGATGTGCATC -3'
(R):5'- TTCCACTGGCAGGACTTCTC -3'

Sequencing Primer
(F):5'- GGCCAGATGTGCATCAATTTC -3'
(R):5'- CTGGCAGGACTTCTCAGATAACG -3'
Posted On2016-07-06