Incidental Mutation 'R5198:Pacs1'
ID 400527
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5198 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 5133688-5273119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5139297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 757 (D757G)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably benign
Transcript: ENSMUST00000025786
AA Change: D757G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: D757G

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Meta Mutation Damage Score 0.0790 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Adgrb1 A T 15: 74,543,701 Q710L probably null Het
Alox12 T C 11: 70,254,417 E110G probably damaging Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gdpd5 T A 7: 99,438,308 Y60N probably damaging Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Olfr625-ps1 T C 7: 103,682,729 S4P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rfx3 T C 19: 27,830,776 D189G probably damaging Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Zfp616 G A 11: 74,083,510 V293I probably benign Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
R8339:Pacs1 UTSW 19 5142623 missense probably damaging 1.00
R8930:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5138936 missense probably benign 0.23
R9211:Pacs1 UTSW 19 5139029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGGTGAATCGTCCCCATC -3'
(R):5'- GGCTGTTTCAGACGTGTAAAG -3'

Sequencing Primer
(F):5'- GGTGAATCGTCCCCATCACCTG -3'
(R):5'- ACTGCTGGCTACATGTTG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R51980056_PCR_F: 5’- ACAGGTGAATCGTCCCCATC-3’

R51980056_PCR_R: 5’- GGCTGTTTCAGACGTGTAAAG-3’

 

Sequencing Primers

R51980056_SEQ_F: 5’- GGTGAATCGTCCCCATCACCTG-3’
 

R51980056_SEQ_R: 5’- ACTGCTGGCTACATGTTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 422 nucleotides is amplified:

 

acaggtgaat cgtccccatc acctgtcaaa gggacaaaca cagttggcca gaggcagtca       

cccttgacct gctggtggca ggaggtgtgc tttcctttca gtgggcccca gggtctcctc      

tgaggaatga cccagacctt cccgctcaac tgcctccgtg agcacatgca gccaattaca      

gcacagagtg ctgggaaagc atggtctcac tcagaagcaa aggcactcta gtttacctgc      

agtggagggc gagtcttcaa caaggcccac tttcacaacc tgtagagatg gggcttttgt      

taggtcctct gtcagggtag caagccccaa tccaactata accaacatgt agccagcagt      

acaaccataa ctacatggtg ttttgtcaat gactaaaaaa tctttacacg tctgaaacag      

cc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>C).
Posted On 2016-07-06