Incidental Mutation 'R5199:Ndufb3'
ID400531
Institutional Source Beutler Lab
Gene Symbol Ndufb3
Ensembl Gene ENSMUSG00000026032
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex 3
Synonyms
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58586384-58595964 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 58591122 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027193] [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161000] [ENSMUST00000161600]
Predicted Effect unknown
Transcript: ENSMUST00000027193
AA Change: H11D
SMART Domains Protein: ENSMUSP00000027193
Gene: ENSMUSG00000026032
AA Change: H11D

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:NDUF_B12 48 104 1.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038372
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097724
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160546
Predicted Effect probably benign
Transcript: ENSMUST00000161000
SMART Domains Protein: ENSMUSP00000125653
Gene: ENSMUSG00000038174

DomainStartEndE-ValueType
Pfam:Hyccin 20 99 3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161600
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Ndufb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Ndufb3 APN 1 58595799 missense possibly damaging 0.95
IGL00563:Ndufb3 APN 1 58595799 missense possibly damaging 0.95
IGL01615:Ndufb3 APN 1 58595753 nonsense probably null
R5014:Ndufb3 UTSW 1 58591242 missense probably damaging 0.96
R7243:Ndufb3 UTSW 1 58591123 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCTTGGAGTCTCATTGTC -3'
(R):5'- AGATACATGCCTACCCTCCTGC -3'

Sequencing Primer
(F):5'- GCTTGGAGTCTCATTGTCTTCATC -3'
(R):5'- TGCCTGCCCCAGTACAC -3'
Posted On2016-07-06