Incidental Mutation 'R5238:Kidins220'
ID400532
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Namekinase D-interacting substrate 220
SynonymsC330002I19Rik, 3110039L19Rik
MMRRC Submission 042809-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5238 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24974925-25063152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25003010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 433 (T433K)
Ref Sequence ENSEMBL: ENSMUSP00000152683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
Predicted Effect probably benign
Transcript: ENSMUST00000066652
AA Change: T433K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: T433K

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220459
AA Change: T391K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221050
Predicted Effect unknown
Transcript: ENSMUST00000222013
AA Change: T262K
Predicted Effect probably benign
Transcript: ENSMUST00000222941
AA Change: T433K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,163,368 probably null Het
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Bclaf1 T G 10: 20,332,384 probably benign Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Col20a1 T C 2: 180,998,586 V512A probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dffa T G 4: 149,104,303 L18R probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Gm12185 G A 11: 48,908,217 T483I possibly damaging Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tiprl A G 1: 165,215,768 V263A probably benign Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25038560 splice site probably benign
IGL00959:Kidins220 APN 12 25051133 missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25057474 missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25010926 missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25038499 missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25040460 missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 24995000 missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25057729 missense probably benign 0.00
IGL02160:Kidins220 APN 12 25004111 missense probably damaging 1.00
IGL02383:Kidins220 APN 12 24997333 splice site probably benign
IGL02673:Kidins220 APN 12 24994992 missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25003093 missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25003045 missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25008448 missense probably damaging 0.99
IGL03412:Kidins220 APN 12 24999345 missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25008156 missense probably damaging 1.00
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25040512 missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25010141 missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25008069 missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25005088 missense probably benign 0.35
R1778:Kidins220 UTSW 12 25013446 splice site probably benign
R1808:Kidins220 UTSW 12 25003009 missense probably benign 0.00
R1855:Kidins220 UTSW 12 25056591 missense probably damaging 1.00
R1965:Kidins220 UTSW 12 24994906 missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25051194 missense probably benign 0.01
R2069:Kidins220 UTSW 12 24987006 splice site probably benign
R2101:Kidins220 UTSW 12 25057423 missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25041303 critical splice donor site probably null
R2371:Kidins220 UTSW 12 25057324 missense probably damaging 1.00
R2405:Kidins220 UTSW 12 25011509 missense probably damaging 0.99
R3522:Kidins220 UTSW 12 24990758 missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25001565 splice site probably benign
R3915:Kidins220 UTSW 12 25053958 missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25057144 intron probably null
R4287:Kidins220 UTSW 12 25056846 missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25011001 missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25038302 intron probably null
R4627:Kidins220 UTSW 12 25057042 missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25057285 missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25013443 critical splice donor site probably null
R4960:Kidins220 UTSW 12 24992260 nonsense probably null
R5118:Kidins220 UTSW 12 24992297 missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25051126 missense probably benign 0.17
R5580:Kidins220 UTSW 12 25047897 missense probably benign 0.00
R5707:Kidins220 UTSW 12 25013391 missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25057140 nonsense probably null
R6131:Kidins220 UTSW 12 24992314 splice site probably null
R6146:Kidins220 UTSW 12 25052813 missense probably damaging 1.00
R6151:Kidins220 UTSW 12 25056909 missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 24997311 missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25051308 intron probably null
R6289:Kidins220 UTSW 12 25056616 missense probably damaging 1.00
R6321:Kidins220 UTSW 12 25057534 missense probably benign 0.09
R6450:Kidins220 UTSW 12 25057191 missense probably benign
R6513:Kidins220 UTSW 12 25038435 missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25010060 splice site probably null
R6711:Kidins220 UTSW 12 24998751 missense probably damaging 0.96
R6858:Kidins220 UTSW 12 25008543 missense possibly damaging 0.85
R7102:Kidins220 UTSW 12 25057663 missense probably benign 0.00
R7112:Kidins220 UTSW 12 25004019 missense probably damaging 1.00
R7139:Kidins220 UTSW 12 24994821 missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25036624 missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25011571 missense probably benign 0.21
R7361:Kidins220 UTSW 12 25057000 missense probably benign 0.01
R7509:Kidins220 UTSW 12 24982361 missense probably damaging 0.98
R7510:Kidins220 UTSW 12 24992269 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGAAAGCATCATTTGTCAGCAC -3'
(R):5'- TGTCTAGACTTCCCAAACATGCC -3'

Sequencing Primer
(F):5'- GATGACCTCAAATATATCATGACCTC -3'
(R):5'- TAGACTTCCCAAACATGCCTTTAC -3'
Posted On2016-07-06