Incidental Mutation 'R5199:Phlpp1'
ID400533
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106173394 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 464 (V464E)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably damaging
Transcript: ENSMUST00000061047
AA Change: V464E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: V464E

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190105
Meta Mutation Damage Score 0.4668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7957:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTAGACAGCACTGGCGTGATAG -3'
(R):5'- GCGGCATGTGAACAAGCTAG -3'

Sequencing Primer
(F):5'- CGATAAGGCGATGGCAGCC -3'
(R):5'- TGTGAACAAGCTAGAAAAAGAGTGTC -3'
Posted On2016-07-06