Incidental Mutation 'R5199:Olfr1012'
ID400539
Institutional Source Beutler Lab
Gene Symbol Olfr1012
Ensembl Gene ENSMUSG00000075210
Gene Nameolfactory receptor 1012
SynonymsGA_x6K02T2Q125-47239120-47238185, MOR213-6
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85757353-85762766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85760214 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 54 (L54P)
Ref Sequence ENSEMBL: ENSMUSP00000148952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099916] [ENSMUST00000214255] [ENSMUST00000214958]
Predicted Effect probably damaging
Transcript: ENSMUST00000099916
AA Change: L54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097500
Gene: ENSMUSG00000075210
AA Change: L54P

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.7e-47 PFAM
Pfam:7tm_1 40 289 8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214255
AA Change: L54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214958
AA Change: L54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Olfr1012
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Olfr1012 APN 2 85759642 missense probably benign 0.30
IGL02334:Olfr1012 APN 2 85760159 nonsense probably null
IGL03050:Olfr1012 UTSW 2 85759441 makesense probably null
R0399:Olfr1012 UTSW 2 85759904 missense possibly damaging 0.53
R1730:Olfr1012 UTSW 2 85760242 missense possibly damaging 0.91
R2142:Olfr1012 UTSW 2 85759677 missense probably benign 0.07
R2185:Olfr1012 UTSW 2 85760019 missense probably damaging 1.00
R2412:Olfr1012 UTSW 2 85759680 missense probably damaging 0.99
R3552:Olfr1012 UTSW 2 85759893 missense possibly damaging 0.46
R3785:Olfr1012 UTSW 2 85759453 missense probably benign 0.00
R4096:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R4097:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R5206:Olfr1012 UTSW 2 85759623 missense probably benign 0.31
R5444:Olfr1012 UTSW 2 85759919 missense probably benign 0.39
R5567:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5570:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5956:Olfr1012 UTSW 2 85753839 unclassified probably benign
R6406:Olfr1012 UTSW 2 85760307 missense possibly damaging 0.94
R7355:Olfr1012 UTSW 2 85753679 missense probably benign 0.03
R7534:Olfr1012 UTSW 2 85759459 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGTAGCGATCATAAGCCATGGC -3'
(R):5'- TTCTGTACTCCTAGGTGCAAGC -3'

Sequencing Primer
(F):5'- CAGTAGGTAGCATTCACTATAGGCC -3'
(R):5'- TAGGTGCAAGCTCCCAGAG -3'
Posted On2016-07-06