Incidental Mutation 'R0456:Dsc1'
ID40054
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0456 (G1)
Quality Score200
Status Not validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20099112 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 280 (K280E)
Ref Sequence ENSEMBL: ENSMUSP00000042303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect probably damaging
Transcript: ENSMUST00000038710
AA Change: K280E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: K280E

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224432
AA Change: K280E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lrrc4 A G 6: 28,831,104 S171P probably damaging Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Nxn G A 11: 76,263,137 Q291* probably null Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp1r3c C A 19: 36,733,891 E160* probably null Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Sdk2 T C 11: 113,791,466 Y2029C possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sult1e1 A G 5: 87,578,634 L207P possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnfrsf21 A G 17: 43,038,091 E198G probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
R8030:Dsc1 UTSW 18 20089571 missense probably benign
Z1176:Dsc1 UTSW 18 20114538 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGTCACTGGGCATAGCTTGGGA -3'
(R):5'- TGCTTGCATCTAAGAATACTTCAGCACA -3'

Sequencing Primer
(F):5'- GCATGTTGACTGTACTGTAATCATCC -3'
(R):5'- gtgtgtcttgcgtgtgtc -3'
Posted On2013-05-23