Incidental Mutation 'R5199:C130079G13Rik'
ID400547
Institutional Source Beutler Lab
Gene Symbol C130079G13Rik
Ensembl Gene ENSMUSG00000036951
Gene NameRIKEN cDNA C130079G13 gene
Synonyms
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59925214-59937949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59936485 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 200 (L200P)
Ref Sequence ENSEMBL: ENSMUSP00000047032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049476]
Predicted Effect probably damaging
Transcript: ENSMUST00000049476
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047032
Gene: ENSMUSG00000036951
AA Change: L200P

DomainStartEndE-ValueType
Pfam:Abhydrolase_3 1 166 2.3e-31 PFAM
Pfam:Abhydrolase_3 148 254 4e-12 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in C130079G13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:C130079G13Rik APN 3 59932632 missense probably benign
IGL02850:C130079G13Rik APN 3 59936572 missense probably damaging 1.00
R0099:C130079G13Rik UTSW 3 59936435 missense probably benign 0.00
R0206:C130079G13Rik UTSW 3 59932689 missense probably damaging 1.00
R0208:C130079G13Rik UTSW 3 59932689 missense probably damaging 1.00
R0457:C130079G13Rik UTSW 3 59936633 missense possibly damaging 0.78
R0511:C130079G13Rik UTSW 3 59936350 missense possibly damaging 0.79
R1824:C130079G13Rik UTSW 3 59932580 nonsense probably null
R2567:C130079G13Rik UTSW 3 59929054 splice site probably benign
R2844:C130079G13Rik UTSW 3 59936409 missense probably benign 0.05
R3826:C130079G13Rik UTSW 3 59936475 missense possibly damaging 0.89
R4356:C130079G13Rik UTSW 3 59936280 missense probably damaging 1.00
R4755:C130079G13Rik UTSW 3 59936314 missense probably benign
R4975:C130079G13Rik UTSW 3 59932740 missense probably damaging 0.98
R7221:C130079G13Rik UTSW 3 59928933 start gained probably benign
R7336:C130079G13Rik UTSW 3 59932753 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAATTCTGACCAGGGAGATG -3'
(R):5'- CTGGTGAATGATAGGGCTCCATG -3'

Sequencing Primer
(F):5'- TGGCATGCCTATATGTGACTGAAGAC -3'
(R):5'- GAATGATAGGGCTCCATGTATTCC -3'
Posted On2016-07-06