Incidental Mutation 'R5199:Tmem245'
ID400552
Institutional Source Beutler Lab
Gene Symbol Tmem245
Ensembl Gene ENSMUSG00000055296
Gene Nametransmembrane protein 245
Synonyms
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56866923-56947437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56925149 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 324 (S324L)
Ref Sequence ENSEMBL: ENSMUSP00000103234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068792] [ENSMUST00000107609] [ENSMUST00000132816]
Predicted Effect probably benign
Transcript: ENSMUST00000068792
AA Change: S324L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000067421
Gene: ENSMUSG00000055296
AA Change: S324L

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
Pfam:UPF0118 589 838 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107609
AA Change: S324L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103234
Gene: ENSMUSG00000055296
AA Change: S324L

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
Pfam:UPF0118 585 842 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125082
Predicted Effect probably benign
Transcript: ENSMUST00000132816
SMART Domains Protein: ENSMUSP00000117449
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:UPF0118 182 433 4.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155625
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Tmem245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02472:Tmem245 APN 4 56899119 missense probably damaging 1.00
IGL02668:Tmem245 APN 4 56925081 missense possibly damaging 0.86
IGL03093:Tmem245 APN 4 56886019 missense probably damaging 1.00
R0090:Tmem245 UTSW 4 56899410 missense probably benign
R0116:Tmem245 UTSW 4 56926213 missense probably benign 0.00
R0648:Tmem245 UTSW 4 56906270 missense probably benign 0.38
R0864:Tmem245 UTSW 4 56890837 missense probably damaging 1.00
R1102:Tmem245 UTSW 4 56903200 intron probably benign
R1548:Tmem245 UTSW 4 56906233 nonsense probably null
R1778:Tmem245 UTSW 4 56903968 missense probably damaging 1.00
R1840:Tmem245 UTSW 4 56903947 missense probably benign 0.03
R1942:Tmem245 UTSW 4 56923511 unclassified probably benign
R1969:Tmem245 UTSW 4 56937964 missense probably benign 0.01
R2341:Tmem245 UTSW 4 56937957 missense probably damaging 1.00
R2364:Tmem245 UTSW 4 56899391 missense probably damaging 0.96
R3848:Tmem245 UTSW 4 56926298 unclassified probably benign
R4591:Tmem245 UTSW 4 56910204 missense probably damaging 0.99
R4772:Tmem245 UTSW 4 56937989 splice site probably null
R4779:Tmem245 UTSW 4 56936468 missense possibly damaging 0.65
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R5049:Tmem245 UTSW 4 56925057 missense probably benign 0.12
R5061:Tmem245 UTSW 4 56946945 missense possibly damaging 0.94
R5377:Tmem245 UTSW 4 56947084 missense probably damaging 0.99
R5547:Tmem245 UTSW 4 56910156 critical splice donor site probably null
R5846:Tmem245 UTSW 4 56903241 missense probably benign 0.00
R5851:Tmem245 UTSW 4 56916770 missense probably benign 0.02
R5991:Tmem245 UTSW 4 56916733 missense probably damaging 1.00
R6314:Tmem245 UTSW 4 56888592 missense possibly damaging 0.88
R6992:Tmem245 UTSW 4 56937940 missense probably benign 0.03
R7172:Tmem245 UTSW 4 56903946 missense possibly damaging 0.65
R7632:Tmem245 UTSW 4 56916787 missense probably benign 0.00
R7660:Tmem245 UTSW 4 56899170 missense possibly damaging 0.79
R7672:Tmem245 UTSW 4 56947069 missense probably benign
R7735:Tmem245 UTSW 4 56925155 missense probably benign 0.22
R7900:Tmem245 UTSW 4 56924973 splice site probably null
R7983:Tmem245 UTSW 4 56924973 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTGTGAAGGTAAATCCACAC -3'
(R):5'- TCCCAGAATCCTGATTTTCCTAGAC -3'

Sequencing Primer
(F):5'- CTGTGAAGGTAAATCCACACTTAAGC -3'
(R):5'- TAGACCAGGACCCTGATGG -3'
Posted On2016-07-06