Incidental Mutation 'R5199:Oas1d'
ID400569
Institutional Source Beutler Lab
Gene Symbol Oas1d
Ensembl Gene ENSMUSG00000032623
Gene Name2'-5' oligoadenylate synthetase 1D
Synonyms
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120914536-120921652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120919145 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 271 (K271N)
Ref Sequence ENSEMBL: ENSMUSP00000048054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044224]
Predicted Effect probably benign
Transcript: ENSMUST00000044224
AA Change: K271N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048054
Gene: ENSMUSG00000032623
AA Change: K271N

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:OAS1_C 168 353 9.4e-76 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Homozygous null females exhibit reduced fertility due to defects in ovarian follicle development and decreased efficiency of ovulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Oas1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Oas1d APN 5 120919207 missense possibly damaging 0.90
IGL01062:Oas1d APN 5 120919064 nonsense probably null
IGL01114:Oas1d APN 5 120916844 missense probably benign 0.08
IGL02336:Oas1d APN 5 120919048 missense probably damaging 1.00
IGL02444:Oas1d APN 5 120920008 missense probably benign 0.25
R0080:Oas1d UTSW 5 120916892 missense possibly damaging 0.61
R0388:Oas1d UTSW 5 120917028 missense probably damaging 1.00
R0674:Oas1d UTSW 5 120919986 missense probably benign
R1344:Oas1d UTSW 5 120914896 missense probably damaging 1.00
R1719:Oas1d UTSW 5 120919962 missense possibly damaging 0.79
R1771:Oas1d UTSW 5 120915837 missense probably damaging 0.98
R3810:Oas1d UTSW 5 120914986 missense probably damaging 1.00
R4516:Oas1d UTSW 5 120919170 missense probably damaging 1.00
R4559:Oas1d UTSW 5 120916895 missense probably benign 0.00
R4819:Oas1d UTSW 5 120915717 missense probably damaging 1.00
R4926:Oas1d UTSW 5 120915768 missense probably benign
R5392:Oas1d UTSW 5 120916940 missense possibly damaging 0.95
R5695:Oas1d UTSW 5 120915011 missense probably benign
R5769:Oas1d UTSW 5 120916854 missense probably benign 0.00
R6259:Oas1d UTSW 5 120919181 nonsense probably null
R7276:Oas1d UTSW 5 120916881 missense possibly damaging 0.48
R7446:Oas1d UTSW 5 120919991 missense probably benign
R7808:Oas1d UTSW 5 120914971 nonsense probably null
Z1176:Oas1d UTSW 5 120914914 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTGGCAGCCGAATTGAGC -3'
(R):5'- TGACAGAGCTCACACCTCTC -3'

Sequencing Primer
(F):5'- AATTGAGCCTGTGAGAAGTGTCCC -3'
(R):5'- CCCTTTTCACAGGATTGCAGC -3'
Posted On2016-07-06