Mutagenetix > Incidental Mutation

Incidental Mutation 'R5239:Ago1'

400579

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

042810-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R5239 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 126441215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 405 (H405N)

Ref Sequence

ENSEMBL: ENSMUSP00000134871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000097888
AA Change: H709N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: H709N

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156533

Predicted Effect

probably damaging
Transcript: ENSMUST00000176315
AA Change: H405N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: H405N

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Meta Mutation Damage Score

0.9394

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,836	N168S	probably benign	Het
Adam3	T	A	8: 24,694,191	T598S	possibly damaging	Het
Atp8b4	T	C	2: 126,392,861		probably null	Het
Baz1a	A	G	12: 54,898,344	S1409P	probably damaging	Het
Brinp2	T	C	1: 158,251,338	E305G	probably benign	Het
Bub1	T	A	2: 127,821,696	R262W	probably damaging	Het
Cish	T	A	9: 107,299,912		probably null	Het
Clip4	T	A	17: 71,799,077	I85K	probably damaging	Het
Cpsf2	T	A	12: 101,987,273	C187*	probably null	Het
Ddx51	C	A	5: 110,653,648	T54K	probably benign	Het
Drc1	A	T	5: 30,363,123	T603S	probably benign	Het
Eif3l	T	A	15: 79,089,795	M470K	possibly damaging	Het
Entpd2	A	G	2: 25,400,818	T445A	probably damaging	Het
Epha1	C	A	6: 42,365,010	V369L	possibly damaging	Het
Galnt9	T	A	5: 110,544,769	L23H	probably damaging	Het
Gm1110	A	G	9: 26,893,570	F399S	probably benign	Het
Gm43972	G	A	5: 25,661,121		noncoding transcript	Het
Gm6489	T	A	1: 31,287,270		noncoding transcript	Het
Grik5	A	T	7: 25,065,470	M82K	probably damaging	Het
Hibch	T	C	1: 52,865,608	Y121H	probably damaging	Het
Hyou1	T	A	9: 44,385,263	I495N	possibly damaging	Het
Il1rl2	T	C	1: 40,365,095	S459P	probably benign	Het
Kel	A	T	6: 41,688,114	L254*	probably null	Het
Lasp1	A	G	11: 97,799,860	K23E	probably damaging	Het
Lemd2	C	A	17: 27,203,799	R207L	possibly damaging	Het
Mum1	C	T	10: 80,228,421	R14*	probably null	Het
Myh1	A	T	11: 67,215,225	Q1222L	probably benign	Het
Myh2	G	A	11: 67,192,443	V1411I	probably benign	Het
Myo1f	T	C	17: 33,601,735	F851L	probably benign	Het
Myom3	G	A	4: 135,800,992		probably benign	Het
Nbas	C	A	12: 13,441,518	L1464I	probably benign	Het
Nr2e3	G	T	9: 59,949,776		probably benign	Het
Nrxn1	T	C	17: 90,704,109	D364G	probably damaging	Het
Olfr1015	T	G	2: 85,785,658	I49S	probably damaging	Het
Olfr1385	A	G	11: 49,494,728	H65R	possibly damaging	Het
Olfr493	T	A	7: 108,346,646	T112S	probably benign	Het
Olfr969	T	A	9: 39,796,196	S274T	probably damaging	Het
Otog	T	A	7: 46,287,435	S1523T	probably benign	Het
Pcnx2	A	T	8: 125,861,082		probably null	Het
Pkdcc	C	A	17: 83,215,984	H173Q	probably damaging	Het
Pkn1	A	G	8: 83,684,182	L267P	probably damaging	Het
Polr1a	A	G	6: 71,913,037	H80R	probably damaging	Het
Rag1	G	T	2: 101,642,955	A614E	possibly damaging	Het
Ryr1	T	C	7: 29,036,128	D4075G	probably damaging	Het
Sdk2	C	A	11: 113,868,033	R455L	probably damaging	Het
Smoc2	A	G	17: 14,368,965	N232S	probably benign	Het
Snd1	T	C	6: 28,545,525	L360P	probably damaging	Het
Tmem26	T	A	10: 68,751,266	F181L	probably damaging	Het
Tnrc6a	A	G	7: 123,186,619	M1512V	probably benign	Het
Tsc22d1	T	A	14: 76,418,412	I20N	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r122	T	C	7: 21,134,098	T11A	possibly damaging	Het
Vpreb1	A	T	16: 16,868,728	Y99*	probably null	Het
Wnt9b	A	T	11: 103,731,228		probably null	Het
Zfp143	A	G	7: 110,094,352	E604G	probably damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAGACCAGAGAGCCAGGA -3'
(R):5'- CAGATGTACTGTCAGGACCCA -3'

Sequencing Primer
(F):5'- TGGAGGACGGGCCACAAAG -3'
(R):5'- GCATCAGCTTATAAAGGTCATGTGC -3'

Posted On

2016-07-06