Incidental Mutation 'R5199:Vmn1r178'
ID400583
Institutional Source Beutler Lab
Gene Symbol Vmn1r178
Ensembl Gene ENSMUSG00000062598
Gene Namevomeronasal 1 receptor 178
SynonymsV1rd13, LOC232959
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23892009-23895622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23894389 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 214 (L214F)
Ref Sequence ENSEMBL: ENSMUSP00000154374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078593] [ENSMUST00000226450] [ENSMUST00000226489] [ENSMUST00000226640] [ENSMUST00000227993]
Predicted Effect probably benign
Transcript: ENSMUST00000078593
AA Change: L287F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077666
Gene: ENSMUSG00000062598
AA Change: L287F

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 7.9e-11 PFAM
Pfam:7tm_1 15 283 2.5e-7 PFAM
Pfam:V1R 41 296 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226450
AA Change: L287F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000226489
AA Change: L214F

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000226640
AA Change: L214F

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227993
AA Change: L287F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Vmn1r178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Vmn1r178 APN 7 23893689 missense probably damaging 0.99
IGL01781:Vmn1r178 APN 7 23894009 missense probably damaging 1.00
IGL01934:Vmn1r178 APN 7 23893937 missense probably damaging 1.00
IGL02571:Vmn1r178 APN 7 23894235 missense probably damaging 0.99
IGL02727:Vmn1r178 APN 7 23894446 unclassified probably null
IGL03112:Vmn1r178 APN 7 23893661 missense probably damaging 1.00
R0112:Vmn1r178 UTSW 7 23894184 missense possibly damaging 0.93
R0830:Vmn1r178 UTSW 7 23894027 missense possibly damaging 0.91
R1186:Vmn1r178 UTSW 7 23893892 nonsense probably null
R1340:Vmn1r178 UTSW 7 23893856 missense probably benign 0.34
R1640:Vmn1r178 UTSW 7 23894123 missense possibly damaging 0.70
R1696:Vmn1r178 UTSW 7 23894200 missense probably damaging 0.99
R1746:Vmn1r178 UTSW 7 23893904 missense probably benign 0.00
R3084:Vmn1r178 UTSW 7 23893906 missense possibly damaging 0.94
R4368:Vmn1r178 UTSW 7 23894022 missense probably damaging 1.00
R6380:Vmn1r178 UTSW 7 23893559 missense possibly damaging 0.62
R7000:Vmn1r178 UTSW 7 23894337 missense probably benign 0.21
R7142:Vmn1r178 UTSW 7 23893610 missense probably damaging 1.00
R7268:Vmn1r178 UTSW 7 23893953 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCTCCATAGACATCGCCAG -3'
(R):5'- CATTGAGCACCTTGCCTTG -3'

Sequencing Primer
(F):5'- TCCCAATCAGGATGCCAGAGG -3'
(R):5'- CACCTTGCCTTGTTGATGCAAAAG -3'
Posted On2016-07-06