Incidental Mutation 'R5199:Gpat4'
ID400594
Institutional Source Beutler Lab
Gene Symbol Gpat4
Ensembl Gene ENSMUSG00000031545
Gene Nameglycerol-3-phosphate acyltransferase 4
SynonymsAgpat6
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location23171265-23208346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23182696 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 46 (V46A)
Ref Sequence ENSEMBL: ENSMUSP00000147679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167004] [ENSMUST00000209507]
Predicted Effect probably benign
Transcript: ENSMUST00000167004
AA Change: V168A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127325
Gene: ENSMUSG00000031545
AA Change: V168A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
PlsC 242 353 9.31e-24 SMART
Blast:PlsC 368 413 7e-18 BLAST
low complexity region 414 425 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209507
AA Change: V46A

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211260
Meta Mutation Damage Score 0.1709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
PHENOTYPE: Nursing mothers homozygous for a gene trap allele display underdeveloped mammary glands that are depleted in intracellular fat droplets and lack the ability to produce diacylglycerol- and triacylglycerol-rich milk; pups nursed by mutant mothers die neonatally unless transferred to foster mothers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Gpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpat4 APN 8 23182775 missense probably damaging 0.97
IGL01660:Gpat4 APN 8 23175338 critical splice donor site probably null
IGL01688:Gpat4 APN 8 23181845 missense probably benign 0.03
IGL02749:Gpat4 APN 8 23180870 missense probably damaging 1.00
R0076:Gpat4 UTSW 8 23190705 splice site probably benign
R0362:Gpat4 UTSW 8 23180933 missense probably benign 0.05
R0961:Gpat4 UTSW 8 23180911 missense probably damaging 0.96
R1876:Gpat4 UTSW 8 23179470 missense possibly damaging 0.82
R1959:Gpat4 UTSW 8 23182936 missense possibly damaging 0.81
R2217:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2313:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2315:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2969:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3110:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3112:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3774:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3775:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3826:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3828:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3829:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3830:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3943:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3944:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R4384:Gpat4 UTSW 8 23174586 missense probably benign 0.05
R4685:Gpat4 UTSW 8 23182849 utr 5 prime probably benign
R5120:Gpat4 UTSW 8 23180202 missense possibly damaging 0.77
R5491:Gpat4 UTSW 8 23180664 missense probably benign 0.38
X0062:Gpat4 UTSW 8 23190711 splice site probably null
X0064:Gpat4 UTSW 8 23175394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTAAGAGACGGTGCCC -3'
(R):5'- AGTAGTAAAGCTCTGGATAAGACACC -3'

Sequencing Primer
(F):5'- TAAGAGACGGTGCCCAGTGC -3'
(R):5'- TCTGGATAAGACACCCGAGTTCG -3'
Posted On2016-07-06