Incidental Mutation 'R5199:Dhps'
ID400599
Institutional Source Beutler Lab
Gene Symbol Dhps
Ensembl Gene ENSMUSG00000060038
Gene Namedeoxyhypusine synthase
Synonyms
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85071757-85075162 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85073406 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 162 (G162R)
Ref Sequence ENSEMBL: ENSMUSP00000077733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078665] [ENSMUST00000093357] [ENSMUST00000149050] [ENSMUST00000152785] [ENSMUST00000152871]
Predicted Effect probably damaging
Transcript: ENSMUST00000078665
AA Change: G162R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077733
Gene: ENSMUSG00000060038
AA Change: G162R

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:DS 44 354 7.1e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093357
SMART Domains Protein: ENSMUSP00000091048
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 98 137 8.1e-9 SMART
WD40 142 179 5.52e-2 SMART
WD40 182 219 1.66e0 SMART
WD40 222 263 7e-4 SMART
WD40 266 304 4.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136696
Predicted Effect probably benign
Transcript: ENSMUST00000142201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146900
Predicted Effect probably benign
Transcript: ENSMUST00000149050
SMART Domains Protein: ENSMUSP00000121568
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152186
Predicted Effect probably benign
Transcript: ENSMUST00000152785
SMART Domains Protein: ENSMUSP00000122127
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 140 177 5.52e-2 SMART
WD40 180 217 1.66e0 SMART
WD40 220 261 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152871
SMART Domains Protein: ENSMUSP00000120308
Gene: ENSMUSG00000060038

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:DS 59 142 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154575
Meta Mutation Damage Score 0.7521 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Dhps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02519:Dhps APN 8 85073299 missense probably damaging 1.00
IGL02689:Dhps APN 8 85073750 missense possibly damaging 0.86
R0648:Dhps UTSW 8 85073282 splice site probably null
R2027:Dhps UTSW 8 85072611 missense probably damaging 1.00
R5366:Dhps UTSW 8 85074784 missense probably damaging 1.00
R5728:Dhps UTSW 8 85073335 missense probably damaging 1.00
R5895:Dhps UTSW 8 85074251 missense probably benign 0.35
R7243:Dhps UTSW 8 85074938 missense probably benign 0.01
R7574:Dhps UTSW 8 85072552 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACCCAGGTTAGGTTGCTG -3'
(R):5'- TCTTACTATGCAGGTCCCCGAG -3'

Sequencing Primer
(F):5'- ACCCAGGTTAGGTTGCTGCTTAG -3'
(R):5'- ACCTCTGTGTTCTGCTCCAG -3'
Posted On2016-07-06