Incidental Mutation 'R5239:Gm1110'
ID400610
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission 042810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5239 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26893570 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 399 (F399S)
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect probably benign
Transcript: ENSMUST00000115261
AA Change: F399S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: F399S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217197
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,836 N168S probably benign Het
Adam3 T A 8: 24,694,191 T598S possibly damaging Het
Ago1 G T 4: 126,441,215 H405N probably damaging Het
Atp8b4 T C 2: 126,392,861 probably null Het
Baz1a A G 12: 54,898,344 S1409P probably damaging Het
Brinp2 T C 1: 158,251,338 E305G probably benign Het
Bub1 T A 2: 127,821,696 R262W probably damaging Het
Cish T A 9: 107,299,912 probably null Het
Clip4 T A 17: 71,799,077 I85K probably damaging Het
Cpsf2 T A 12: 101,987,273 C187* probably null Het
Ddx51 C A 5: 110,653,648 T54K probably benign Het
Drc1 A T 5: 30,363,123 T603S probably benign Het
Eif3l T A 15: 79,089,795 M470K possibly damaging Het
Entpd2 A G 2: 25,400,818 T445A probably damaging Het
Epha1 C A 6: 42,365,010 V369L possibly damaging Het
Galnt9 T A 5: 110,544,769 L23H probably damaging Het
Gm43972 G A 5: 25,661,121 noncoding transcript Het
Gm6489 T A 1: 31,287,270 noncoding transcript Het
Grik5 A T 7: 25,065,470 M82K probably damaging Het
Hibch T C 1: 52,865,608 Y121H probably damaging Het
Hyou1 T A 9: 44,385,263 I495N possibly damaging Het
Il1rl2 T C 1: 40,365,095 S459P probably benign Het
Kel A T 6: 41,688,114 L254* probably null Het
Lasp1 A G 11: 97,799,860 K23E probably damaging Het
Lemd2 C A 17: 27,203,799 R207L possibly damaging Het
Mum1 C T 10: 80,228,421 R14* probably null Het
Myh1 A T 11: 67,215,225 Q1222L probably benign Het
Myh2 G A 11: 67,192,443 V1411I probably benign Het
Myo1f T C 17: 33,601,735 F851L probably benign Het
Myom3 G A 4: 135,800,992 probably benign Het
Nbas C A 12: 13,441,518 L1464I probably benign Het
Nr2e3 G T 9: 59,949,776 probably benign Het
Nrxn1 T C 17: 90,704,109 D364G probably damaging Het
Olfr1015 T G 2: 85,785,658 I49S probably damaging Het
Olfr1385 A G 11: 49,494,728 H65R possibly damaging Het
Olfr493 T A 7: 108,346,646 T112S probably benign Het
Olfr969 T A 9: 39,796,196 S274T probably damaging Het
Otog T A 7: 46,287,435 S1523T probably benign Het
Pcnx2 A T 8: 125,861,082 probably null Het
Pkdcc C A 17: 83,215,984 H173Q probably damaging Het
Pkn1 A G 8: 83,684,182 L267P probably damaging Het
Polr1a A G 6: 71,913,037 H80R probably damaging Het
Rag1 G T 2: 101,642,955 A614E possibly damaging Het
Ryr1 T C 7: 29,036,128 D4075G probably damaging Het
Sdk2 C A 11: 113,868,033 R455L probably damaging Het
Smoc2 A G 17: 14,368,965 N232S probably benign Het
Snd1 T C 6: 28,545,525 L360P probably damaging Het
Tmem26 T A 10: 68,751,266 F181L probably damaging Het
Tnrc6a A G 7: 123,186,619 M1512V probably benign Het
Tsc22d1 T A 14: 76,418,412 I20N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r122 T C 7: 21,134,098 T11A possibly damaging Het
Vpreb1 A T 16: 16,868,728 Y99* probably null Het
Wnt9b A T 11: 103,731,228 probably null Het
Zfp143 A G 7: 110,094,352 E604G probably damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0189:Gm1110 UTSW 9 26883218 missense probably null 0.99
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2567:Gm1110 UTSW 9 26920696 missense probably benign
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4271:Gm1110 UTSW 9 26895648 critical splice donor site probably null
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 splice site probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7579:Gm1110 UTSW 9 26883826 missense possibly damaging 0.93
R7990:Gm1110 UTSW 9 26880841 missense possibly damaging 0.66
R8062:Gm1110 UTSW 9 26881821 missense probably damaging 0.99
R8108:Gm1110 UTSW 9 26920661 missense probably damaging 1.00
R8323:Gm1110 UTSW 9 26902423 critical splice donor site probably null
R8354:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8354:Gm1110 UTSW 9 26883281 missense probably benign 0.00
R8454:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8454:Gm1110 UTSW 9 26883281 missense probably benign 0.00
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGAGCTCTTACAATTGGTTTCC -3'
(R):5'- CTACATGACTGGGTCCTTCG -3'

Sequencing Primer
(F):5'- ACAATTGGTTTCCTATTCTCAAGTG -3'
(R):5'- CCTTCGTTGGTGGAGGC -3'
Posted On2016-07-06