Mutagenetix > Incidental Mutations

Incidental Mutation 'R5199:Psme4'

400615

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

042775-MU

Accession Numbers

Genbank: NM_134013

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5199 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30853272 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 38 (E38G)

Ref Sequence

ENSEMBL: ENSMUSP00000114537 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: E1539G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: E1539G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129824
AA Change: E38G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0607

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1a	T	C	5: 121,521,152	E26G	probably benign	Het
Adar	T	A	3: 89,745,944	M797K	probably damaging	Het
Amdhd1	A	T	10: 93,525,985	C352S	probably damaging	Het
AW554918	C	A	18: 25,340,299	R387S	probably damaging	Het
C130079G13Rik	T	C	3: 59,936,485	L200P	probably damaging	Het
Cabp1	A	G	5: 115,186,043	V5A	possibly damaging	Het
Carmil1	A	G	13: 24,111,870	L387P	probably damaging	Het
Cds2	T	A	2: 132,298,483	H200Q	probably damaging	Het
Cep170b	T	A	12: 112,744,147	L1470Q	probably damaging	Het
Cnnm1	A	G	19: 43,494,986	D956G	possibly damaging	Het
Cnot8	C	T	11: 58,115,274	Q210*	probably null	Het
Cpne8	G	A	15: 90,648,609	T65I	probably benign	Het
Crygn	A	G	5: 24,756,158	V50A	probably damaging	Het
Cxcr4	A	G	1: 128,589,546	V126A	probably damaging	Het
Cyp4f15	A	G	17: 32,702,372	D464G	probably benign	Het
Dapp1	C	T	3: 137,981,385	S12N	probably benign	Het
Dhps	G	A	8: 85,073,406	G162R	probably damaging	Het
Dsp	T	G	13: 38,192,902	Y1554*	probably null	Het
Etl4	G	T	2: 20,744,042	R397L	probably damaging	Het
Ezh2	C	T	6: 47,551,725	C291Y	probably benign	Het
Gbp9	T	C	5: 105,083,812	S303G	probably benign	Het
Gm11444	A	C	11: 85,848,019	S83A	unknown	Het
Gm156	T	A	6: 129,775,818	Y8F	possibly damaging	Het
Gpat4	A	G	8: 23,182,696	V46A	possibly damaging	Het
Haus6	T	C	4: 86,582,985	D883G	possibly damaging	Het
Hinfp	T	C	9: 44,296,392	E439G	probably benign	Het
Ifna14	T	A	4: 88,571,362	Y146F	probably damaging	Het
Igkv3-3	A	T	6: 70,687,504	Y110F	probably damaging	Het
Kansl2-ps	A	G	7: 72,673,194		noncoding transcript	Het
Mcmdc2	T	C	1: 9,920,435	V279A	probably benign	Het
Mug2	T	A	6: 122,040,660	V452D	probably benign	Het
Ndufb3	C	G	1: 58,591,122		probably benign	Het
Oas1d	G	T	5: 120,919,145	K271N	probably benign	Het
Olfr1012	A	G	2: 85,760,214	L54P	probably damaging	Het
Olfr1215	T	A	2: 89,001,763	H175L	possibly damaging	Het
Olfr203	T	A	16: 59,303,740	F196I	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcnt	T	A	10: 76,418,544	H817L	probably benign	Het
Per3	G	T	4: 151,012,895	S724R	probably benign	Het
Phlpp1	T	A	1: 106,173,394	V464E	probably damaging	Het
Qtrt2	T	C	16: 43,867,425	N264S	probably benign	Het
Ranbp2	G	A	10: 58,464,443	R557H	probably benign	Het
Rptor	T	A	11: 119,603,816	S3T	probably benign	Het
Saxo1	T	A	4: 86,487,782	Y60F	probably damaging	Het
St3gal1	A	G	15: 67,113,715	V30A	probably benign	Het
Tmem245	G	A	4: 56,925,149	S324L	probably benign	Het
Topbp1	A	G	9: 103,346,672		probably benign	Het
Urb1	T	C	16: 90,792,748	T382A	possibly damaging	Het
Vmn1r178	A	T	7: 23,894,389	L214F	probably benign	Het
Vmn2r82	G	A	10: 79,396,087	C640Y	probably damaging	Het
Vsx2	A	G	12: 84,593,210	D281G	probably benign	Het
Zfp804b	A	T	5: 6,770,013	C1017S	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	intron	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	intron	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	intron	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	intron	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGAGCTGTAACTTTTGAACCTC -3'
(R):5'- GGTGATGCATGCTTTTAATCCTAAC -3'

Sequencing Primer
(F):5'- CAGTTTTAATTTTCATGTCAAACCCC -3'
(R):5'- GCTACCTGGTCAGACAGTATC -3'

Posted On

2016-07-06