Incidental Mutation 'R5199:Cnot8'
ID400616
Institutional Source Beutler Lab
Gene Symbol Cnot8
Ensembl Gene ENSMUSG00000020515
Gene NameCCR4-NOT transcription complex, subunit 8
Synonyms
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58104153-58118594 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 58115274 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 210 (Q210*)
Ref Sequence ENSEMBL: ENSMUSP00000104471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020822] [ENSMUST00000108843] [ENSMUST00000134896] [ENSMUST00000172035]
Predicted Effect probably null
Transcript: ENSMUST00000020822
AA Change: Q210*
SMART Domains Protein: ENSMUSP00000020822
Gene: ENSMUSG00000020515
AA Change: Q210*

DomainStartEndE-ValueType
Pfam:CAF1 15 139 4.3e-15 PFAM
Pfam:CAF1 138 238 1.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108843
AA Change: Q210*
SMART Domains Protein: ENSMUSP00000104471
Gene: ENSMUSG00000020515
AA Change: Q210*

DomainStartEndE-ValueType
Pfam:CAF1 13 240 1.3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133923
Predicted Effect probably benign
Transcript: ENSMUST00000134896
SMART Domains Protein: ENSMUSP00000116116
Gene: ENSMUSG00000020515

DomainStartEndE-ValueType
Pfam:CAF1 13 75 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172035
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Cnot8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Cnot8 APN 11 58111362 missense probably damaging 1.00
IGL01774:Cnot8 APN 11 58115307 missense probably benign 0.01
IGL02877:Cnot8 APN 11 58111402 missense probably benign 0.01
straws UTSW 11 58114065 missense probably damaging 1.00
R0465:Cnot8 UTSW 11 58114060 missense probably damaging 0.99
R1802:Cnot8 UTSW 11 58117535 missense probably benign 0.01
R2418:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R2419:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R5257:Cnot8 UTSW 11 58117522 missense possibly damaging 0.94
R5317:Cnot8 UTSW 11 58113203 missense probably damaging 1.00
R5351:Cnot8 UTSW 11 58115321 missense probably damaging 1.00
R5702:Cnot8 UTSW 11 58114047 missense possibly damaging 0.71
R6106:Cnot8 UTSW 11 58113990 missense probably damaging 0.96
R6261:Cnot8 UTSW 11 58114051 missense probably damaging 1.00
R6419:Cnot8 UTSW 11 58114065 missense probably damaging 1.00
R6947:Cnot8 UTSW 11 58117505 missense probably benign 0.03
R7070:Cnot8 UTSW 11 58117452 missense probably benign 0.00
R7888:Cnot8 UTSW 11 58111311 missense probably benign
R7971:Cnot8 UTSW 11 58111311 missense probably benign
Z1176:Cnot8 UTSW 11 58113090 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGGGTACTGTTTGGGAAGAAT -3'
(R):5'- CAGCCTCTGTAGATAGACTAACAA -3'

Sequencing Primer
(F):5'- GTACTGTTTGGGAAGAATAAGAGTG -3'
(R):5'- CATTCCTACTGTAGAAAGCAGAAG -3'
Posted On2016-07-06