Incidental Mutation 'R5199:Vsx2'
ID400619
Institutional Source Beutler Lab
Gene Symbol Vsx2
Ensembl Gene ENSMUSG00000021239
Gene Namevisual system homeobox 2
SynonymsHox10, Chx10, Hox-10
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84569762-84595457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84593210 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 281 (D281G)
Ref Sequence ENSEMBL: ENSMUSP00000021665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021665] [ENSMUST00000169934]
Predicted Effect probably benign
Transcript: ENSMUST00000021665
AA Change: D281G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021665
Gene: ENSMUSG00000021239
AA Change: D281G

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 284 295 N/A INTRINSIC
Pfam:OAR 299 319 4.3e-10 PFAM
low complexity region 334 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169934
AA Change: D300G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131009
Gene: ENSMUSG00000021239
AA Change: D300G

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 303 314 N/A INTRINSIC
Pfam:OAR 319 337 6.6e-10 PFAM
low complexity region 353 369 N/A INTRINSIC
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a member of the Vsx (visual system homeobox) family which belongs to the larger PRD homeobox class. The encoded protein is required for eye organogenesis and controls retinal development. Disruption of this gene is associated with ocular retardation J (orJ), a mouse disease which causes microphthalmia, retinal degeneration and optic nerve aplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microphthalmia, lack of retinal intercellular channels, and agenesis of the optic nerve. Homozygotes for one mutant allele also have a germ cell maturation defect with sterility in both sexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Vsx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:Vsx2 APN 12 84570300 missense probably benign 0.09
R0005:Vsx2 UTSW 12 84570241 missense possibly damaging 0.78
R0413:Vsx2 UTSW 12 84570003 missense probably benign 0.00
R1256:Vsx2 UTSW 12 84576311 missense probably damaging 1.00
R3438:Vsx2 UTSW 12 84570211 missense probably damaging 0.98
R6481:Vsx2 UTSW 12 84593104 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAGAAAGGCGGCTTTC -3'
(R):5'- TAAGCCATGTCCTCCAGCTG -3'

Sequencing Primer
(F):5'- AAAGGCGGCTTTCTGCTC -3'
(R):5'- ATGTCCTCCAGCTGCGGTG -3'
Posted On2016-07-06