Incidental Mutation 'R0456:Ppp1r3c'
ID40062
Institutional Source Beutler Lab
Gene Symbol Ppp1r3c
Ensembl Gene ENSMUSG00000067279
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3C
Synonymsprotein targeting to glicogen, Ppp1r5, PTG
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0456 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36731737-36736653 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 36733891 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 160 (E160*)
Ref Sequence ENSEMBL: ENSMUSP00000084578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087321]
Predicted Effect probably null
Transcript: ENSMUST00000087321
AA Change: E160*
SMART Domains Protein: ENSMUSP00000084578
Gene: ENSMUSG00000067279
AA Change: E160*

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
Pfam:CBM_21 151 257 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carbohydrate binding protein that is a subunit of the protein phosphatase 1 (PP1) complex. PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities. The encoded protein affects glycogen biosynthesis by activating glycogen synthase and limiting glycogen breakdown by reducing glycogen phosphorylase activity. DNA hypermethylation of this gene has been found in colorectal cancer patients. The encoded protein also interacts with the laforin protein, which is a protein tyrosine phosphatase implicated in Lafora disease. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice are embyronic lethal. Heterozygotes have reduced glycogen stores, attenuated glycogen synthesis, glucose intolerance, hyperinsulinemia and insulin resistance. Mice homozygous for a different knock-out allele exhibit normal lifespan with enhanced whole body insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Dsc1 T C 18: 20,099,112 K280E probably damaging Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lrrc4 A G 6: 28,831,104 S171P probably damaging Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Nxn G A 11: 76,263,137 Q291* probably null Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Sdk2 T C 11: 113,791,466 Y2029C possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sult1e1 A G 5: 87,578,634 L207P possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnfrsf21 A G 17: 43,038,091 E198G probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Ppp1r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ppp1r3c APN 19 36734103 missense probably damaging 1.00
IGL00486:Ppp1r3c APN 19 36733924 missense probably damaging 1.00
IGL01865:Ppp1r3c APN 19 36734178 missense probably benign 0.00
IGL02896:Ppp1r3c APN 19 36733465 missense probably benign 0.26
R0110:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0450:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0469:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R1539:Ppp1r3c UTSW 19 36733961 missense probably benign
R1859:Ppp1r3c UTSW 19 36733611 missense probably damaging 1.00
R2228:Ppp1r3c UTSW 19 36733698 missense probably benign
R2229:Ppp1r3c UTSW 19 36733698 missense probably benign
R4534:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4535:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4619:Ppp1r3c UTSW 19 36734343 missense possibly damaging 0.94
R4630:Ppp1r3c UTSW 19 36733515 missense probably benign 0.02
R6015:Ppp1r3c UTSW 19 36733806 missense probably damaging 1.00
Z1177:Ppp1r3c UTSW 19 36733918 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CATTGTTGTCCCAGAAGATCCTCCC -3'
(R):5'- TCTTCTCCGACCTTCCAGAAGAACC -3'

Sequencing Primer
(F):5'- TCCTCAGTTGGAATGACACG -3'
(R):5'- TTCCAGAAGAACCAGCGTG -3'
Posted On2013-05-23