Incidental Mutation 'R5239:Tmem26'
ID400620
Institutional Source Beutler Lab
Gene Symbol Tmem26
Ensembl Gene ENSMUSG00000060044
Gene Nametransmembrane protein 26
Synonyms
MMRRC Submission 042810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5239 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location68723646-68782650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68751266 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 181 (F181L)
Ref Sequence ENSEMBL: ENSMUSP00000079789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080995] [ENSMUST00000218918] [ENSMUST00000219392]
Predicted Effect probably damaging
Transcript: ENSMUST00000080995
AA Change: F181L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079789
Gene: ENSMUSG00000060044
AA Change: F181L

DomainStartEndE-ValueType
Pfam:Tmem26 3 304 5.6e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218918
Predicted Effect probably benign
Transcript: ENSMUST00000219392
Meta Mutation Damage Score 0.3817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,836 N168S probably benign Het
Adam3 T A 8: 24,694,191 T598S possibly damaging Het
Ago1 G T 4: 126,441,215 H405N probably damaging Het
Atp8b4 T C 2: 126,392,861 probably null Het
Baz1a A G 12: 54,898,344 S1409P probably damaging Het
Brinp2 T C 1: 158,251,338 E305G probably benign Het
Bub1 T A 2: 127,821,696 R262W probably damaging Het
Cish T A 9: 107,299,912 probably null Het
Clip4 T A 17: 71,799,077 I85K probably damaging Het
Cpsf2 T A 12: 101,987,273 C187* probably null Het
Ddx51 C A 5: 110,653,648 T54K probably benign Het
Drc1 A T 5: 30,363,123 T603S probably benign Het
Eif3l T A 15: 79,089,795 M470K possibly damaging Het
Entpd2 A G 2: 25,400,818 T445A probably damaging Het
Epha1 C A 6: 42,365,010 V369L possibly damaging Het
Galnt9 T A 5: 110,544,769 L23H probably damaging Het
Gm1110 A G 9: 26,893,570 F399S probably benign Het
Gm43972 G A 5: 25,661,121 noncoding transcript Het
Gm6489 T A 1: 31,287,270 noncoding transcript Het
Grik5 A T 7: 25,065,470 M82K probably damaging Het
Hibch T C 1: 52,865,608 Y121H probably damaging Het
Hyou1 T A 9: 44,385,263 I495N possibly damaging Het
Il1rl2 T C 1: 40,365,095 S459P probably benign Het
Kel A T 6: 41,688,114 L254* probably null Het
Lasp1 A G 11: 97,799,860 K23E probably damaging Het
Lemd2 C A 17: 27,203,799 R207L possibly damaging Het
Mum1 C T 10: 80,228,421 R14* probably null Het
Myh1 A T 11: 67,215,225 Q1222L probably benign Het
Myh2 G A 11: 67,192,443 V1411I probably benign Het
Myo1f T C 17: 33,601,735 F851L probably benign Het
Myom3 G A 4: 135,800,992 probably benign Het
Nbas C A 12: 13,441,518 L1464I probably benign Het
Nr2e3 G T 9: 59,949,776 probably benign Het
Nrxn1 T C 17: 90,704,109 D364G probably damaging Het
Olfr1015 T G 2: 85,785,658 I49S probably damaging Het
Olfr1385 A G 11: 49,494,728 H65R possibly damaging Het
Olfr493 T A 7: 108,346,646 T112S probably benign Het
Olfr969 T A 9: 39,796,196 S274T probably damaging Het
Otog T A 7: 46,287,435 S1523T probably benign Het
Pcnx2 A T 8: 125,861,082 probably null Het
Pkdcc C A 17: 83,215,984 H173Q probably damaging Het
Pkn1 A G 8: 83,684,182 L267P probably damaging Het
Polr1a A G 6: 71,913,037 H80R probably damaging Het
Rag1 G T 2: 101,642,955 A614E possibly damaging Het
Ryr1 T C 7: 29,036,128 D4075G probably damaging Het
Sdk2 C A 11: 113,868,033 R455L probably damaging Het
Smoc2 A G 17: 14,368,965 N232S probably benign Het
Snd1 T C 6: 28,545,525 L360P probably damaging Het
Tnrc6a A G 7: 123,186,619 M1512V probably benign Het
Tsc22d1 T A 14: 76,418,412 I20N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r122 T C 7: 21,134,098 T11A possibly damaging Het
Vpreb1 A T 16: 16,868,728 Y99* probably null Het
Wnt9b A T 11: 103,731,228 probably null Het
Zfp143 A G 7: 110,094,352 E604G probably damaging Het
Other mutations in Tmem26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmem26 APN 10 68775354 missense probably damaging 1.00
IGL00471:Tmem26 APN 10 68778681 missense possibly damaging 0.78
IGL01301:Tmem26 APN 10 68778606 missense probably damaging 1.00
IGL01567:Tmem26 APN 10 68751231 missense probably damaging 1.00
IGL02487:Tmem26 APN 10 68778733 missense probably benign 0.00
IGL02713:Tmem26 APN 10 68751295 missense probably damaging 1.00
IGL02828:Tmem26 APN 10 68775385 critical splice donor site probably null
ANU18:Tmem26 UTSW 10 68778606 missense probably damaging 1.00
P0027:Tmem26 UTSW 10 68778718 missense probably benign 0.00
R1415:Tmem26 UTSW 10 68778661 missense possibly damaging 0.93
R1649:Tmem26 UTSW 10 68751273 missense probably damaging 1.00
R3871:Tmem26 UTSW 10 68778732 missense probably benign 0.01
R5072:Tmem26 UTSW 10 68775348 missense probably damaging 1.00
R6053:Tmem26 UTSW 10 68748484 missense probably benign 0.00
R6607:Tmem26 UTSW 10 68778713 missense probably benign 0.00
R6710:Tmem26 UTSW 10 68724054 missense probably damaging 1.00
R7378:Tmem26 UTSW 10 68724092 critical splice donor site probably null
T0722:Tmem26 UTSW 10 68778718 missense probably benign 0.00
X0003:Tmem26 UTSW 10 68778718 missense probably benign 0.00
Z1177:Tmem26 UTSW 10 68723963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACACTGTTGACCAGGAGC -3'
(R):5'- GCTGTCTTTAAAAGCCTTACATATGCC -3'

Sequencing Primer
(F):5'- GAACCTGATGTCTCTGTTCAACAGG -3'
(R):5'- AGCCTTACATATGCCACATACAG -3'
Posted On2016-07-06