Incidental Mutation 'R5199:Cpne8'
ID400627
Institutional Source Beutler Lab
Gene Symbol Cpne8
Ensembl Gene ENSMUSG00000052560
Gene Namecopine VIII
Synonyms1200003E11Rik, 1500031E20Rik
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location90487482-90679432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90648609 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 65 (T65I)
Ref Sequence ENSEMBL: ENSMUSP00000014777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014777] [ENSMUST00000064391] [ENSMUST00000088649]
Predicted Effect probably benign
Transcript: ENSMUST00000014777
AA Change: T65I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000014777
Gene: ENSMUSG00000052560
AA Change: T65I

DomainStartEndE-ValueType
Blast:C2 37 75 6e-21 BLAST
SCOP:d1bdya_ 38 64 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064391
AA Change: T65I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067774
Gene: ENSMUSG00000052560
AA Change: T65I

DomainStartEndE-ValueType
C2 37 145 9.76e-10 SMART
C2 170 277 1.06e-10 SMART
low complexity region 284 291 N/A INTRINSIC
VWA 320 518 1.34e-9 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088649
AA Change: T65I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000086024
Gene: ENSMUSG00000052560
AA Change: T65I

DomainStartEndE-ValueType
C2 37 139 8.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154569
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a member of the copine family of highly conserved, calcium-dependent phospholipid binding proteins. The encoded protein has two characteristic C2 domains and a VWFA domain and may play a role in membrane trafficking. A related pseudogene is found on chromosome 8. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Qtrt2 T C 16: 43,867,425 N264S probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Cpne8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Cpne8 APN 15 90497058 splice site probably benign
IGL00545:Cpne8 APN 15 90540259 missense probably benign
IGL00951:Cpne8 APN 15 90601893 intron probably benign
IGL01069:Cpne8 APN 15 90615110 critical splice donor site probably null
IGL01294:Cpne8 APN 15 90501445 missense probably damaging 0.96
IGL01720:Cpne8 APN 15 90501500 missense probably benign 0.01
IGL01843:Cpne8 APN 15 90569497 missense probably benign 0.17
PIT4431001:Cpne8 UTSW 15 90551975 missense probably damaging 0.98
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0096:Cpne8 UTSW 15 90499915 missense probably benign 0.24
R0545:Cpne8 UTSW 15 90497075 missense probably damaging 1.00
R0637:Cpne8 UTSW 15 90648621 missense probably damaging 1.00
R0834:Cpne8 UTSW 15 90540259 missense probably benign
R0894:Cpne8 UTSW 15 90649271 missense probably damaging 0.97
R1568:Cpne8 UTSW 15 90619642 missense probably damaging 0.98
R1629:Cpne8 UTSW 15 90571972 missense probably benign 0.03
R1747:Cpne8 UTSW 15 90584915 missense probably benign 0.00
R1761:Cpne8 UTSW 15 90648618 missense probably damaging 1.00
R1884:Cpne8 UTSW 15 90648628 splice site probably benign
R2357:Cpne8 UTSW 15 90619674 missense probably damaging 0.99
R2434:Cpne8 UTSW 15 90509511 missense probably benign 0.07
R4043:Cpne8 UTSW 15 90572001 missense probably damaging 1.00
R4875:Cpne8 UTSW 15 90648568 splice site probably benign
R4969:Cpne8 UTSW 15 90619726 missense probably damaging 1.00
R4981:Cpne8 UTSW 15 90679235 missense probably benign 0.05
R5086:Cpne8 UTSW 15 90648568 splice site probably benign
R5154:Cpne8 UTSW 15 90499918 missense probably benign 0.10
R5424:Cpne8 UTSW 15 90516057 missense probably benign 0.00
R5528:Cpne8 UTSW 15 90619690 missense possibly damaging 0.95
R5946:Cpne8 UTSW 15 90488988 makesense probably null
R6158:Cpne8 UTSW 15 90571988 missense probably damaging 1.00
R6977:Cpne8 UTSW 15 90497091 missense probably benign 0.10
R7486:Cpne8 UTSW 15 90515906 critical splice donor site probably null
R7522:Cpne8 UTSW 15 90601819 missense probably benign 0.09
R7684:Cpne8 UTSW 15 90649247 missense probably damaging 1.00
R7726:Cpne8 UTSW 15 90501418 missense possibly damaging 0.94
R7799:Cpne8 UTSW 15 90540247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGGAGTGCAATTTAGC -3'
(R):5'- AGTACTTTTGCCCCAGGTTG -3'

Sequencing Primer
(F):5'- CTTTGGGTTGAGCAACACT -3'
(R):5'- CCCCAGGTTGGCACTTTAAG -3'
Posted On2016-07-06