Incidental Mutation 'R5199:Qtrt2'
ID400632
Institutional Source Beutler Lab
Gene Symbol Qtrt2
Ensembl Gene ENSMUSG00000022704
Gene Namequeuine tRNA-ribosyltransferase accessory subunit 2
Synonyms3110012M05Rik, 4930470H18Rik
MMRRC Submission 042775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5199 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location43861407-43926809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43867425 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 264 (N264S)
Ref Sequence ENSEMBL: ENSMUSP00000023387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023387]
Predicted Effect probably benign
Transcript: ENSMUST00000023387
AA Change: N264S

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023387
Gene: ENSMUSG00000022704
AA Change: N264S

DomainStartEndE-ValueType
Pfam:TGT 95 340 7.1e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156568
Meta Mutation Damage Score 0.0953 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,521,152 E26G probably benign Het
Adar T A 3: 89,745,944 M797K probably damaging Het
Amdhd1 A T 10: 93,525,985 C352S probably damaging Het
AW554918 C A 18: 25,340,299 R387S probably damaging Het
C130079G13Rik T C 3: 59,936,485 L200P probably damaging Het
Cabp1 A G 5: 115,186,043 V5A possibly damaging Het
Carmil1 A G 13: 24,111,870 L387P probably damaging Het
Cds2 T A 2: 132,298,483 H200Q probably damaging Het
Cep170b T A 12: 112,744,147 L1470Q probably damaging Het
Cnnm1 A G 19: 43,494,986 D956G possibly damaging Het
Cnot8 C T 11: 58,115,274 Q210* probably null Het
Cpne8 G A 15: 90,648,609 T65I probably benign Het
Crygn A G 5: 24,756,158 V50A probably damaging Het
Cxcr4 A G 1: 128,589,546 V126A probably damaging Het
Cyp4f15 A G 17: 32,702,372 D464G probably benign Het
Dapp1 C T 3: 137,981,385 S12N probably benign Het
Dhps G A 8: 85,073,406 G162R probably damaging Het
Dsp T G 13: 38,192,902 Y1554* probably null Het
Etl4 G T 2: 20,744,042 R397L probably damaging Het
Ezh2 C T 6: 47,551,725 C291Y probably benign Het
Gbp9 T C 5: 105,083,812 S303G probably benign Het
Gm11444 A C 11: 85,848,019 S83A unknown Het
Gm156 T A 6: 129,775,818 Y8F possibly damaging Het
Gpat4 A G 8: 23,182,696 V46A possibly damaging Het
Haus6 T C 4: 86,582,985 D883G possibly damaging Het
Hinfp T C 9: 44,296,392 E439G probably benign Het
Ifna14 T A 4: 88,571,362 Y146F probably damaging Het
Igkv3-3 A T 6: 70,687,504 Y110F probably damaging Het
Kansl2-ps A G 7: 72,673,194 noncoding transcript Het
Mcmdc2 T C 1: 9,920,435 V279A probably benign Het
Mug2 T A 6: 122,040,660 V452D probably benign Het
Ndufb3 C G 1: 58,591,122 probably benign Het
Oas1d G T 5: 120,919,145 K271N probably benign Het
Olfr1012 A G 2: 85,760,214 L54P probably damaging Het
Olfr1215 T A 2: 89,001,763 H175L possibly damaging Het
Olfr203 T A 16: 59,303,740 F196I probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcnt T A 10: 76,418,544 H817L probably benign Het
Per3 G T 4: 151,012,895 S724R probably benign Het
Phlpp1 T A 1: 106,173,394 V464E probably damaging Het
Psme4 A G 11: 30,853,272 E38G probably benign Het
Ranbp2 G A 10: 58,464,443 R557H probably benign Het
Rptor T A 11: 119,603,816 S3T probably benign Het
Saxo1 T A 4: 86,487,782 Y60F probably damaging Het
St3gal1 A G 15: 67,113,715 V30A probably benign Het
Tmem245 G A 4: 56,925,149 S324L probably benign Het
Topbp1 A G 9: 103,346,672 probably benign Het
Urb1 T C 16: 90,792,748 T382A possibly damaging Het
Vmn1r178 A T 7: 23,894,389 L214F probably benign Het
Vmn2r82 G A 10: 79,396,087 C640Y probably damaging Het
Vsx2 A G 12: 84,593,210 D281G probably benign Het
Zfp804b A T 5: 6,770,013 C1017S probably benign Het
Other mutations in Qtrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Qtrt2 APN 16 43881189 missense probably damaging 0.99
R1018:Qtrt2 UTSW 16 43878000 missense possibly damaging 0.93
R1258:Qtrt2 UTSW 16 43869083 missense possibly damaging 0.77
R1499:Qtrt2 UTSW 16 43868974 missense probably benign 0.43
R1574:Qtrt2 UTSW 16 43871832 unclassified probably benign
R1830:Qtrt2 UTSW 16 43871655 missense probably damaging 1.00
R2013:Qtrt2 UTSW 16 43869092 missense probably damaging 1.00
R3835:Qtrt2 UTSW 16 43881072 missense probably damaging 1.00
R7449:Qtrt2 UTSW 16 43881032 missense probably benign 0.06
R7621:Qtrt2 UTSW 16 43868940 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAAGTACCCAAAGGCATCCG -3'
(R):5'- TTCTAAGAATGGAGTTACGGGG -3'

Sequencing Primer
(F):5'- CCAAAGGCATCCGCAGAGG -3'
(R):5'- CTAAGAATGGAGTTACGGGGTTAAAG -3'
Posted On2016-07-06