Incidental Mutation 'R5239:Baz1a'
ID 400637
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Name bromodomain adjacent to zinc finger domain 1A
Synonyms Gtl5, Wcrf180, Acf1
MMRRC Submission 042810-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5239 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 54939774-55061133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54945129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1409 (S1409P)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
AlphaFold O88379
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: S1412P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: S1412P

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: S1409P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: S1409P

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173453
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,244,848 (GRCm39) N168S probably benign Het
Adam3 T A 8: 25,184,207 (GRCm39) T598S possibly damaging Het
Ago1 G T 4: 126,335,008 (GRCm39) H405N probably damaging Het
Atp8b4 T C 2: 126,234,781 (GRCm39) probably null Het
Brinp2 T C 1: 158,078,908 (GRCm39) E305G probably benign Het
Bub1 T A 2: 127,663,616 (GRCm39) R262W probably damaging Het
Cish T A 9: 107,177,111 (GRCm39) probably null Het
Clip4 T A 17: 72,106,072 (GRCm39) I85K probably damaging Het
Cpsf2 T A 12: 101,953,532 (GRCm39) C187* probably null Het
Ddx51 C A 5: 110,801,514 (GRCm39) T54K probably benign Het
Drc1 A T 5: 30,520,467 (GRCm39) T603S probably benign Het
Eif3l T A 15: 78,973,995 (GRCm39) M470K possibly damaging Het
Entpd2 A G 2: 25,290,830 (GRCm39) T445A probably damaging Het
Epha1 C A 6: 42,341,944 (GRCm39) V369L possibly damaging Het
Galnt9 T A 5: 110,692,635 (GRCm39) L23H probably damaging Het
Gm1110 A G 9: 26,804,866 (GRCm39) F399S probably benign Het
Gm43972 G A 5: 25,866,119 (GRCm39) noncoding transcript Het
Gm6489 T A 1: 31,326,351 (GRCm39) noncoding transcript Het
Grik5 A T 7: 24,764,895 (GRCm39) M82K probably damaging Het
Hibch T C 1: 52,904,767 (GRCm39) Y121H probably damaging Het
Hyou1 T A 9: 44,296,560 (GRCm39) I495N possibly damaging Het
Il1rl2 T C 1: 40,404,255 (GRCm39) S459P probably benign Het
Kel A T 6: 41,665,048 (GRCm39) L254* probably null Het
Lasp1 A G 11: 97,690,686 (GRCm39) K23E probably damaging Het
Lemd2 C A 17: 27,422,773 (GRCm39) R207L possibly damaging Het
Myh1 A T 11: 67,106,051 (GRCm39) Q1222L probably benign Het
Myh2 G A 11: 67,083,269 (GRCm39) V1411I probably benign Het
Myo1f T C 17: 33,820,709 (GRCm39) F851L probably benign Het
Myom3 G A 4: 135,528,303 (GRCm39) probably benign Het
Nbas C A 12: 13,491,519 (GRCm39) L1464I probably benign Het
Nr2e3 G T 9: 59,857,059 (GRCm39) probably benign Het
Nrxn1 T C 17: 91,011,537 (GRCm39) D364G probably damaging Het
Or2y1 A G 11: 49,385,555 (GRCm39) H65R possibly damaging Het
Or5p68 T A 7: 107,945,853 (GRCm39) T112S probably benign Het
Or8g54 T A 9: 39,707,492 (GRCm39) S274T probably damaging Het
Or9g4b T G 2: 85,616,002 (GRCm39) I49S probably damaging Het
Otog T A 7: 45,936,859 (GRCm39) S1523T probably benign Het
Pcnx2 A T 8: 126,587,821 (GRCm39) probably null Het
Pkdcc C A 17: 83,523,413 (GRCm39) H173Q probably damaging Het
Pkn1 A G 8: 84,410,811 (GRCm39) L267P probably damaging Het
Polr1a A G 6: 71,890,021 (GRCm39) H80R probably damaging Het
Pwwp3a C T 10: 80,064,255 (GRCm39) R14* probably null Het
Rag1 G T 2: 101,473,300 (GRCm39) A614E possibly damaging Het
Ryr1 T C 7: 28,735,553 (GRCm39) D4075G probably damaging Het
Sdk2 C A 11: 113,758,859 (GRCm39) R455L probably damaging Het
Smoc2 A G 17: 14,589,227 (GRCm39) N232S probably benign Het
Snd1 T C 6: 28,545,524 (GRCm39) L360P probably damaging Het
Tmem26 T A 10: 68,587,096 (GRCm39) F181L probably damaging Het
Tnrc6a A G 7: 122,785,842 (GRCm39) M1512V probably benign Het
Tsc22d1 T A 14: 76,655,852 (GRCm39) I20N probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vmn1r122 T C 7: 20,868,023 (GRCm39) T11A possibly damaging Het
Vpreb1a A T 16: 16,686,592 (GRCm39) Y99* probably null Het
Wnt9b A T 11: 103,622,054 (GRCm39) probably null Het
Zfp143 A G 7: 109,693,559 (GRCm39) E604G probably damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54,963,516 (GRCm39) missense probably benign
IGL01138:Baz1a APN 12 54,977,110 (GRCm39) missense probably damaging 1.00
IGL01298:Baz1a APN 12 55,001,594 (GRCm39) missense probably damaging 1.00
IGL02639:Baz1a APN 12 54,942,810 (GRCm39) splice site probably benign
IGL02995:Baz1a APN 12 54,947,232 (GRCm39) missense probably damaging 1.00
IGL03001:Baz1a APN 12 54,969,896 (GRCm39) missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54,941,743 (GRCm39) missense probably damaging 1.00
IGL03135:Baz1a APN 12 54,976,375 (GRCm39) missense probably damaging 1.00
IGL03151:Baz1a APN 12 54,955,934 (GRCm39) critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54,945,320 (GRCm39) missense probably damaging 1.00
IGL03240:Baz1a APN 12 54,974,352 (GRCm39) nonsense probably null
Bezos UTSW 12 54,941,816 (GRCm39) nonsense probably null
Flavia UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
gumdrops UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
Kilter UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
Kisses UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
liverlips UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
smooch UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
Smootch UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54,977,095 (GRCm39) missense probably benign 0.03
R0127:Baz1a UTSW 12 54,945,491 (GRCm39) missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54,958,172 (GRCm39) missense probably damaging 1.00
R0393:Baz1a UTSW 12 54,965,221 (GRCm39) critical splice donor site probably null
R0532:Baz1a UTSW 12 54,981,605 (GRCm39) missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54,988,304 (GRCm39) nonsense probably null
R0626:Baz1a UTSW 12 55,022,055 (GRCm39) missense probably damaging 0.99
R0654:Baz1a UTSW 12 54,958,182 (GRCm39) missense probably benign 0.01
R0782:Baz1a UTSW 12 54,941,273 (GRCm39) missense probably damaging 1.00
R0826:Baz1a UTSW 12 54,977,097 (GRCm39) nonsense probably null
R0855:Baz1a UTSW 12 54,947,348 (GRCm39) splice site probably benign
R0927:Baz1a UTSW 12 54,941,773 (GRCm39) missense probably damaging 1.00
R0941:Baz1a UTSW 12 54,945,216 (GRCm39) missense probably benign 0.00
R1079:Baz1a UTSW 12 54,941,785 (GRCm39) missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54,976,349 (GRCm39) missense probably damaging 1.00
R1647:Baz1a UTSW 12 55,021,983 (GRCm39) missense probably damaging 1.00
R1731:Baz1a UTSW 12 54,965,330 (GRCm39) missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54,945,573 (GRCm39) nonsense probably null
R1762:Baz1a UTSW 12 54,955,805 (GRCm39) missense probably damaging 1.00
R1770:Baz1a UTSW 12 54,945,293 (GRCm39) missense probably damaging 1.00
R1968:Baz1a UTSW 12 54,947,122 (GRCm39) missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54,976,431 (GRCm39) missense probably damaging 1.00
R2111:Baz1a UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
R2215:Baz1a UTSW 12 55,022,154 (GRCm39) nonsense probably null
R2282:Baz1a UTSW 12 54,963,597 (GRCm39) nonsense probably null
R2875:Baz1a UTSW 12 54,969,904 (GRCm39) missense probably damaging 1.00
R2890:Baz1a UTSW 12 54,945,302 (GRCm39) missense probably benign
R2971:Baz1a UTSW 12 54,970,224 (GRCm39) missense probably damaging 1.00
R3404:Baz1a UTSW 12 54,963,774 (GRCm39) missense probably benign 0.00
R3419:Baz1a UTSW 12 54,993,684 (GRCm39) missense probably benign 0.05
R3699:Baz1a UTSW 12 54,963,831 (GRCm39) missense probably benign 0.09
R3899:Baz1a UTSW 12 54,981,589 (GRCm39) missense probably benign 0.01
R3927:Baz1a UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54,976,404 (GRCm39) missense probably benign 0.00
R4072:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R4196:Baz1a UTSW 12 54,958,200 (GRCm39) missense probably damaging 1.00
R4289:Baz1a UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
R4455:Baz1a UTSW 12 54,958,153 (GRCm39) missense probably benign 0.26
R4583:Baz1a UTSW 12 54,969,325 (GRCm39) missense probably damaging 0.99
R4622:Baz1a UTSW 12 54,988,300 (GRCm39) missense probably benign 0.00
R4807:Baz1a UTSW 12 54,945,267 (GRCm39) missense probably benign 0.28
R4998:Baz1a UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
R5379:Baz1a UTSW 12 54,941,133 (GRCm39) missense probably damaging 1.00
R5408:Baz1a UTSW 12 54,969,835 (GRCm39) missense probably damaging 1.00
R5678:Baz1a UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
R5810:Baz1a UTSW 12 54,974,500 (GRCm39) intron probably benign
R6092:Baz1a UTSW 12 54,955,868 (GRCm39) missense possibly damaging 0.88
R6317:Baz1a UTSW 12 55,001,585 (GRCm39) missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54,965,339 (GRCm39) missense probably benign 0.01
R6803:Baz1a UTSW 12 54,988,340 (GRCm39) missense probably null 0.99
R7185:Baz1a UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
R7248:Baz1a UTSW 12 54,947,293 (GRCm39) missense probably damaging 1.00
R7392:Baz1a UTSW 12 54,945,550 (GRCm39) missense probably damaging 1.00
R8009:Baz1a UTSW 12 54,941,816 (GRCm39) nonsense probably null
R8025:Baz1a UTSW 12 54,955,921 (GRCm39) missense probably benign 0.34
R8392:Baz1a UTSW 12 54,969,908 (GRCm39) missense probably damaging 1.00
R8862:Baz1a UTSW 12 55,032,624 (GRCm39) unclassified probably benign
R8949:Baz1a UTSW 12 54,941,238 (GRCm39) missense probably damaging 1.00
R9340:Baz1a UTSW 12 54,963,372 (GRCm39) missense probably damaging 0.97
R9389:Baz1a UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
R9401:Baz1a UTSW 12 54,963,339 (GRCm39) missense probably damaging 1.00
R9666:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R9722:Baz1a UTSW 12 54,946,882 (GRCm39) missense probably benign 0.43
R9746:Baz1a UTSW 12 55,021,895 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGCTGCCTCTTTAGTGATGTATGC -3'
(R):5'- TTAGTCCTCACAGCAAACGC -3'

Sequencing Primer
(F):5'- GACTGTTGTGTATCATAGGAACAGC -3'
(R):5'- TCCTCACAGCAAACGCAGAGG -3'
Posted On 2016-07-06