Incidental Mutation 'R5200:Tgfbrap1'
ID400641
Institutional Source Beutler Lab
Gene Symbol Tgfbrap1
Ensembl Gene ENSMUSG00000070939
Gene Nametransforming growth factor, beta receptor associated protein 1
Synonyms3110018K12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location43047200-43098637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43075643 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 99 (I99K)
Ref Sequence ENSEMBL: ENSMUSP00000140413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095014] [ENSMUST00000186694] [ENSMUST00000188728] [ENSMUST00000189010] [ENSMUST00000190427]
Predicted Effect probably damaging
Transcript: ENSMUST00000095014
AA Change: I99K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092624
Gene: ENSMUSG00000070939
AA Change: I99K

DomainStartEndE-ValueType
Pfam:CNH 30 293 3.3e-15 PFAM
Pfam:Vps39_1 448 550 3.3e-26 PFAM
Pfam:Clathrin 572 730 5.3e-13 PFAM
Pfam:Vps39_2 738 846 2e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186694
AA Change: I99K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140132
Gene: ENSMUSG00000070939
AA Change: I99K

DomainStartEndE-ValueType
Pfam:CNH 29 293 1.4e-17 PFAM
Pfam:Vps39_1 448 550 4.5e-26 PFAM
Pfam:Clathrin 571 730 8.4e-13 PFAM
Pfam:Vps39_2 738 846 4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187872
Predicted Effect probably benign
Transcript: ENSMUST00000188728
SMART Domains Protein: ENSMUSP00000140169
Gene: ENSMUSG00000070939

DomainStartEndE-ValueType
Pfam:Vps39_1 218 254 3.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189010
AA Change: I99K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000190427
SMART Domains Protein: ENSMUSP00000140384
Gene: ENSMUSG00000070939

DomainStartEndE-ValueType
Pfam:CNH 1 53 2e-4 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to transforming growth factor-beta (TGF-beta) receptors and plays a role in TGF-beta signaling. The encoded protein acts as a chaprone in signaling downstream of TGF-beta. It is involved in signal-dependent association with SMAD4. The protein is also a component of mammalian CORVET, a multisubunit tethering protein complex that is involved in fusion of early endosomes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Tgfbrap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tgfbrap1 APN 1 43060123 missense probably damaging 0.98
IGL02142:Tgfbrap1 APN 1 43062592 missense probably damaging 1.00
IGL02386:Tgfbrap1 APN 1 43075821 missense probably damaging 1.00
IGL02667:Tgfbrap1 APN 1 43067620 missense probably benign 0.04
IGL03039:Tgfbrap1 APN 1 43075928 missense possibly damaging 0.76
askew UTSW 1 43059129 missense probably benign 0.22
R0245:Tgfbrap1 UTSW 1 43075592 missense possibly damaging 0.73
R0609:Tgfbrap1 UTSW 1 43060141 missense probably benign 0.24
R0624:Tgfbrap1 UTSW 1 43059129 missense probably benign 0.22
R1111:Tgfbrap1 UTSW 1 43051976 missense probably benign 0.07
R1184:Tgfbrap1 UTSW 1 43049696 missense possibly damaging 0.65
R1469:Tgfbrap1 UTSW 1 43075458 missense probably benign 0.03
R1469:Tgfbrap1 UTSW 1 43075458 missense probably benign 0.03
R1571:Tgfbrap1 UTSW 1 43049813 missense probably benign 0.21
R1615:Tgfbrap1 UTSW 1 43051985 missense probably benign 0.00
R1704:Tgfbrap1 UTSW 1 43054656 missense probably benign 0.00
R1773:Tgfbrap1 UTSW 1 43075352 missense probably damaging 1.00
R1834:Tgfbrap1 UTSW 1 43071635 missense probably damaging 1.00
R2019:Tgfbrap1 UTSW 1 43054517 critical splice donor site probably null
R2038:Tgfbrap1 UTSW 1 43054634 nonsense probably null
R2926:Tgfbrap1 UTSW 1 43075629 missense probably damaging 1.00
R3842:Tgfbrap1 UTSW 1 43059154 missense probably damaging 0.98
R4345:Tgfbrap1 UTSW 1 43056706 missense probably benign 0.02
R5133:Tgfbrap1 UTSW 1 43075506 missense probably damaging 0.96
R5382:Tgfbrap1 UTSW 1 43075865 missense probably benign 0.01
R5715:Tgfbrap1 UTSW 1 43059937 missense possibly damaging 0.64
R6860:Tgfbrap1 UTSW 1 43067599 missense possibly damaging 0.63
R6921:Tgfbrap1 UTSW 1 43051896 missense probably benign
R6937:Tgfbrap1 UTSW 1 43051904 missense probably damaging 0.99
R7090:Tgfbrap1 UTSW 1 43071565 missense probably damaging 0.99
R7359:Tgfbrap1 UTSW 1 43075533 missense probably damaging 1.00
X0028:Tgfbrap1 UTSW 1 43071650 missense probably damaging 1.00
Z1176:Tgfbrap1 UTSW 1 43060147 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTCGGTCCTCATACACCAG -3'
(R):5'- CACATCAGCATTGAGTGTGTGG -3'

Sequencing Primer
(F):5'- GAAACATTTGGACAGTCCTGCGC -3'
(R):5'- TATGTCGGCACCAATGACTG -3'
Posted On2016-07-06