Incidental Mutation 'R5200:Ankmy1'
ID400645
Institutional Source Beutler Lab
Gene Symbol Ankmy1
Ensembl Gene ENSMUSG00000034212
Gene Nameankyrin repeat and MYND domain containing 1
Synonyms4930483I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92859803-92902906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92870292 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 997 (R997G)
Ref Sequence ENSEMBL: ENSMUSP00000123787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112998] [ENSMUST00000160548]
Predicted Effect probably benign
Transcript: ENSMUST00000112998
AA Change: R996G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108622
Gene: ENSMUSG00000034212
AA Change: R996G

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 940 980 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160548
AA Change: R997G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123787
Gene: ENSMUSG00000034212
AA Change: R997G

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 941 981 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Ankmy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ankmy1 APN 1 92886266 missense probably damaging 1.00
IGL01061:Ankmy1 APN 1 92870974 splice site probably benign
IGL01960:Ankmy1 APN 1 92871663 splice site probably benign
IGL01984:Ankmy1 APN 1 92883765 missense probably damaging 0.99
IGL02193:Ankmy1 APN 1 92881045 missense probably benign 0.03
IGL02536:Ankmy1 APN 1 92886188 missense probably damaging 1.00
IGL02644:Ankmy1 APN 1 92885054 missense probably benign 0.18
IGL02650:Ankmy1 APN 1 92881023 missense probably damaging 1.00
IGL02660:Ankmy1 APN 1 92896094 missense probably damaging 1.00
IGL02808:Ankmy1 APN 1 92886666 missense probably damaging 1.00
PIT4687001:Ankmy1 UTSW 1 92885081 missense probably benign 0.00
R0313:Ankmy1 UTSW 1 92886221 missense probably damaging 1.00
R0373:Ankmy1 UTSW 1 92896190 missense probably damaging 0.99
R0383:Ankmy1 UTSW 1 92885053 missense probably benign 0.00
R0499:Ankmy1 UTSW 1 92886226 missense probably damaging 1.00
R0562:Ankmy1 UTSW 1 92899691 splice site probably benign
R0607:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R0739:Ankmy1 UTSW 1 92888648 missense probably damaging 1.00
R0962:Ankmy1 UTSW 1 92899568 nonsense probably null
R1192:Ankmy1 UTSW 1 92883894 missense probably damaging 0.99
R1491:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R1568:Ankmy1 UTSW 1 92881116 missense probably damaging 1.00
R1585:Ankmy1 UTSW 1 92899651 missense probably benign 0.00
R1590:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R1664:Ankmy1 UTSW 1 92885191 missense probably benign 0.00
R1714:Ankmy1 UTSW 1 92885194 nonsense probably null
R1818:Ankmy1 UTSW 1 92886831 missense probably benign 0.43
R2014:Ankmy1 UTSW 1 92885141 missense probably benign 0.00
R2043:Ankmy1 UTSW 1 92876527 unclassified probably benign
R2056:Ankmy1 UTSW 1 92881831 missense possibly damaging 0.61
R2427:Ankmy1 UTSW 1 92870807 critical splice donor site probably null
R3806:Ankmy1 UTSW 1 92883758 missense possibly damaging 0.92
R3883:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R3884:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R4118:Ankmy1 UTSW 1 92888696 missense possibly damaging 0.60
R4132:Ankmy1 UTSW 1 92885100 missense probably benign
R4441:Ankmy1 UTSW 1 92888661 missense possibly damaging 0.92
R4543:Ankmy1 UTSW 1 92884850 missense probably damaging 1.00
R4602:Ankmy1 UTSW 1 92888650 missense probably benign 0.38
R4779:Ankmy1 UTSW 1 92886723 missense probably benign 0.23
R5381:Ankmy1 UTSW 1 92876562 missense probably benign
R5425:Ankmy1 UTSW 1 92870957 nonsense probably null
R5474:Ankmy1 UTSW 1 92885204 missense possibly damaging 0.59
R5534:Ankmy1 UTSW 1 92886720 missense probably damaging 1.00
R5607:Ankmy1 UTSW 1 92877018 missense probably damaging 1.00
R6112:Ankmy1 UTSW 1 92870962 missense probably damaging 1.00
R6117:Ankmy1 UTSW 1 92861274 unclassified probably benign
R6376:Ankmy1 UTSW 1 92888465 missense possibly damaging 0.60
R6712:Ankmy1 UTSW 1 92870922 missense probably damaging 1.00
R6915:Ankmy1 UTSW 1 92888451 missense probably null 1.00
R7201:Ankmy1 UTSW 1 92886824 missense possibly damaging 0.95
R7432:Ankmy1 UTSW 1 92896079 missense probably benign
R7485:Ankmy1 UTSW 1 92876657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGCCAAGGACTCTGGGAC -3'
(R):5'- CACAGAGAGGGTGGCATTTTG -3'

Sequencing Primer
(F):5'- AAGGACTCTGGGACTTGGC -3'
(R):5'- CATTTTGGTCTAGGTAGCAATGC -3'
Posted On2016-07-06