Incidental Mutation 'R0408:Atg9a'
ID 40065
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 038610-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0408 (G1)
Quality Score 209
Status Not validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75161939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 536 (S536P)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000189702] [ENSMUST00000188347] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect probably benign
Transcript: ENSMUST00000027396
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: S536P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: S536P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: S536P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: S536P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: S536P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: S536P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: S528P
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: S95P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,903,446 (GRCm39) N1032K probably damaging Het
Abcc8 A G 7: 45,756,457 (GRCm39) I1416T probably damaging Het
Aco2 T C 15: 81,797,319 (GRCm39) probably null Het
Akap13 C T 7: 75,396,544 (GRCm39) L2514F probably damaging Het
Aldh1a3 A G 7: 66,055,798 (GRCm39) V331A probably damaging Het
Arid3a T A 10: 79,786,667 (GRCm39) D473E probably benign Het
Atxn7 A T 14: 14,100,317 (GRCm38) S668C probably damaging Het
Bcar3 A T 3: 122,302,033 (GRCm39) I243F probably damaging Het
Bend6 G A 1: 33,901,834 (GRCm39) P183S probably damaging Het
Bfsp2 A T 9: 103,357,299 (GRCm39) S43T probably benign Het
Camk4 G A 18: 33,262,845 (GRCm39) D136N probably damaging Het
Ceacam3 G T 7: 16,885,808 (GRCm39) probably benign Het
Chrm3 T C 13: 9,927,969 (GRCm39) I356V probably benign Het
Clec9a T A 6: 129,396,532 (GRCm39) I133N possibly damaging Het
Ctnnd2 T C 15: 30,634,823 (GRCm39) L157P probably damaging Het
Ddhd2 T C 8: 26,229,614 (GRCm39) probably null Het
Def8 T C 8: 124,186,656 (GRCm39) V436A probably damaging Het
Dipk1c T A 18: 84,738,488 (GRCm39) probably null Het
Dock10 T C 1: 80,518,193 (GRCm39) K1293R probably benign Het
Dync1h1 T G 12: 110,598,126 (GRCm39) D1772E probably benign Het
Ephx4 G T 5: 107,561,387 (GRCm39) G72C probably damaging Het
Fam136a T G 6: 86,343,707 (GRCm39) V68G possibly damaging Het
Fcgrt T C 7: 44,751,363 (GRCm39) E195G probably damaging Het
Fut9 T A 4: 25,620,319 (GRCm39) Q165L possibly damaging Het
Glb1l T C 1: 75,185,479 (GRCm39) Y77C probably damaging Het
Gpr26 T C 7: 131,569,249 (GRCm39) V198A possibly damaging Het
Gpr26 C A 7: 131,576,001 (GRCm39) probably null Het
Gsdma3 A C 11: 98,526,164 (GRCm39) E296A probably benign Het
Hyou1 G T 9: 44,295,989 (GRCm39) G385W probably damaging Het
Il17rb T C 14: 29,718,637 (GRCm39) S482G probably benign Het
Itgb4 A T 11: 115,898,428 (GRCm39) R1715W probably damaging Het
Jak2 A G 19: 29,263,717 (GRCm39) S411G probably benign Het
Kdm3a C T 6: 71,588,663 (GRCm39) D449N probably benign Het
Kifbp T C 10: 62,401,832 (GRCm39) I23M probably benign Het
Klhl26 T C 8: 70,905,130 (GRCm39) D226G probably damaging Het
Klra1 T A 6: 130,354,737 (GRCm39) I94F probably benign Het
Lama3 A G 18: 12,589,894 (GRCm39) D808G probably benign Het
Lrp1b C T 2: 40,567,603 (GRCm39) M272I probably damaging Het
Masp2 A G 4: 148,690,496 (GRCm39) D251G probably benign Het
Mob3b T C 4: 35,083,991 (GRCm39) D66G probably damaging Het
Myo7a T C 7: 97,705,988 (GRCm39) Q1863R probably damaging Het
Naa12 T C 18: 80,255,029 (GRCm39) S108P probably damaging Het
Or10al3 G A 17: 38,012,190 (GRCm39) V210I probably benign Het
Or4c103 A T 2: 88,513,999 (GRCm39) F26I probably benign Het
Pdgfd T A 9: 6,293,928 (GRCm39) Y167* probably null Het
Pfas A G 11: 68,891,931 (GRCm39) probably null Het
Plin1 T A 7: 79,372,394 (GRCm39) T393S probably damaging Het
Prdm15 A T 16: 97,636,986 (GRCm39) N110K possibly damaging Het
Prune2 T A 19: 17,099,674 (GRCm39) V1726D probably benign Het
Sestd1 T A 2: 77,022,137 (GRCm39) D518V probably damaging Het
Setd2 C T 9: 110,423,310 (GRCm39) P344S probably damaging Het
Slc22a1 A T 17: 12,875,828 (GRCm39) I462N probably damaging Het
Slc6a1 G A 6: 114,279,761 (GRCm39) V142I probably benign Het
Tbc1d14 G T 5: 36,728,643 (GRCm39) T241K possibly damaging Het
Uaca T C 9: 60,779,141 (GRCm39) L1176P possibly damaging Het
Ube2g1 G C 11: 72,563,791 (GRCm39) G52A probably damaging Het
Utrn A G 10: 12,259,934 (GRCm39) *957R probably null Het
Vmn2r125 A T 4: 156,703,153 (GRCm39) E177V probably damaging Het
Vmn2r86 A G 10: 130,282,723 (GRCm39) F631S probably damaging Het
Zc3h13 T A 14: 75,529,626 (GRCm39) C42* probably null Het
Zc3h14 T G 12: 98,730,082 (GRCm39) V13G probably damaging Het
Zfat A T 15: 68,052,141 (GRCm39) V551D probably benign Het
Zfp618 C T 4: 63,004,809 (GRCm39) R70W probably damaging Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCGGACTCAGACTGTAAGGAC -3'
(R):5'- TGGCACACAGTAACCTTGGGAAAAC -3'

Sequencing Primer
(F):5'- CTCAGACTGTAAGGACTGGATG -3'
(R):5'- tgaaccatcagtcacactcc -3'
Posted On 2013-05-23