Incidental Mutation 'R5240:Prim2'
ID400665
Institutional Source Beutler Lab
Gene Symbol Prim2
Ensembl Gene ENSMUSG00000026134
Gene NameDNA primase, p58 subunit
Synonyms
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33453810-33669795 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 33480316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027312]
Predicted Effect probably benign
Transcript: ENSMUST00000027312
SMART Domains Protein: ENSMUSP00000027312
Gene: ENSMUSG00000026134

DomainStartEndE-ValueType
Pfam:DNA_primase_lrg 182 448 6.2e-99 PFAM
low complexity region 482 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189552
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Prim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Prim2 APN 1 33512160 missense probably damaging 1.00
IGL02576:Prim2 APN 1 33484717 missense probably damaging 1.00
R0398:Prim2 UTSW 1 33484676 splice site probably benign
R0686:Prim2 UTSW 1 33514189 missense probably benign
R1452:Prim2 UTSW 1 33630404 missense probably benign
R3925:Prim2 UTSW 1 33533299 missense probably damaging 1.00
R4398:Prim2 UTSW 1 33512111 missense probably damaging 1.00
R4831:Prim2 UTSW 1 33670136 unclassified probably benign
R4832:Prim2 UTSW 1 33464064 missense probably benign
R5057:Prim2 UTSW 1 33630360 nonsense probably null
R5294:Prim2 UTSW 1 33668893 missense probably benign 0.11
R5771:Prim2 UTSW 1 33454151 missense unknown
R5807:Prim2 UTSW 1 33480406 intron probably benign
R6307:Prim2 UTSW 1 33662292 missense probably benign 0.00
R7165:Prim2 UTSW 1 33628393 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCATGGAAAACAGCCTTCC -3'
(R):5'- ATGCAGTCCTACAAGATCCCTG -3'

Sequencing Primer
(F):5'- GCCTTCCAAAATGAAAGACTCTATC -3'
(R):5'- TACAAGATCCCTGCCTCGG -3'
Posted On2016-07-06