Incidental Mutation 'R5200:Akap9'
ID400668
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3960734 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 497 (V497A)
Ref Sequence ENSEMBL: ENSMUSP00000117209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: V479A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: V479A

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140977
Predicted Effect probably benign
Transcript: ENSMUST00000143365
AA Change: V497A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177448
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 intron probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
R8036:Akap9 UTSW 5 4070397 nonsense probably null
R8054:Akap9 UTSW 5 4038707 critical splice donor site probably null
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 3962251 missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4046189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTCTCAGATAGAGGAGCTC -3'
(R):5'- CATGCTTGAGCTCGAGTTCC -3'

Sequencing Primer
(F):5'- TGTCTCAGATAGAGGAGCTCAAATCC -3'
(R):5'- TTCTGGATTCGGAGGCAGCC -3'
Posted On2016-07-06