Incidental Mutation 'R5200:Pax4'
ID400674
Institutional Source Beutler Lab
Gene Symbol Pax4
Ensembl Gene ENSMUSG00000029706
Gene Namepaired box 4
SynonymsPax-4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location28442334-28449353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28445139 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 179 (P179L)
Ref Sequence ENSEMBL: ENSMUSP00000126000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031718] [ENSMUST00000164519] [ENSMUST00000171089] [ENSMUST00000174194]
Predicted Effect probably damaging
Transcript: ENSMUST00000031718
AA Change: P179L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031718
Gene: ENSMUSG00000029706
AA Change: P179L

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 170 232 8.92e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164519
AA Change: P179L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131301
Gene: ENSMUSG00000029706
AA Change: P179L

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 170 232 8.92e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171089
AA Change: P179L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126000
Gene: ENSMUSG00000029706
AA Change: P179L

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 170 232 8.92e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174036
Predicted Effect probably benign
Transcript: ENSMUST00000174194
SMART Domains Protein: ENSMUSP00000134470
Gene: ENSMUSG00000029706

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 139 190 2.22e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174423
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The paired box 4 gene is involved in pancreatic islet development and mouse studies have demonstrated a role for this gene in differentiation of insulin-producing beta cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation lack mature insulin- and somatostatin-producing cells (beta and delta, respectively) in the pancreas, but contain glucagon-producing alpha cells in considerably higher numbers relative to wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Pax4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03150:Pax4 APN 6 28444339 missense probably null 1.00
R0034:Pax4 UTSW 6 28442449 missense probably benign
R1523:Pax4 UTSW 6 28444841 missense probably damaging 1.00
R1828:Pax4 UTSW 6 28443447 missense probably benign 0.02
R2014:Pax4 UTSW 6 28446210 missense probably benign 0.01
R4037:Pax4 UTSW 6 28443883 missense probably benign 0.00
R5117:Pax4 UTSW 6 28446279 missense probably benign 0.43
R5163:Pax4 UTSW 6 28446270 missense probably damaging 1.00
R5182:Pax4 UTSW 6 28444369 missense probably benign 0.19
R5713:Pax4 UTSW 6 28446185 missense probably damaging 1.00
R5902:Pax4 UTSW 6 28447127 missense probably benign 0.22
R6185:Pax4 UTSW 6 28446348 missense probably damaging 1.00
R6744:Pax4 UTSW 6 28442397 missense probably benign 0.00
R6923:Pax4 UTSW 6 28447119 critical splice donor site probably null
R7054:Pax4 UTSW 6 28446323 missense probably damaging 1.00
R7165:Pax4 UTSW 6 28446137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGAGGCTCTCACAGTG -3'
(R):5'- ACATGAGAGACCCTGTGTAACC -3'

Sequencing Primer
(F):5'- AGGAATGGTCTCCTTGTCAGTCC -3'
(R):5'- ACCCTGTGTAACCAGAAAGG -3'
Posted On2016-07-06