Incidental Mutation 'R5200:Dmpk'
ID400680
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 19088019 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 301 (L301V)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect probably benign
Transcript: ENSMUST00000154199
AA Change: L301V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTAGTGGCTTGTGCTCCCAG -3'
(R):5'- CTCGAAGTCTGGTGTAAAGGG -3'

Sequencing Primer
(F):5'- CACTGAGTAGGTGTGCGAAGGTC -3'
(R):5'- GGGGTACACTGTCTCGGAG -3'
Posted On2016-07-06