Incidental Mutation 'R5200:Olfr710'
ID400684
Institutional Source Beutler Lab
Gene Symbol Olfr710
Ensembl Gene ENSMUSG00000045581
Gene Nameolfactory receptor 710
SynonymsGA_x6K02T2PBJ9-9325348-9324416, MOR260-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106943911-106948312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106944980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 7 (T7I)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055923
AA Change: T7I

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: T7I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Olfr710
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr710 APN 7 106944541 missense possibly damaging 0.77
IGL01534:Olfr710 APN 7 106944339 missense probably damaging 1.00
IGL02041:Olfr710 APN 7 106944113 missense possibly damaging 0.78
IGL02414:Olfr710 APN 7 106944758 missense probably benign 0.33
IGL02695:Olfr710 APN 7 106944663 missense possibly damaging 0.93
IGL03167:Olfr710 APN 7 106944645 missense probably damaging 0.99
IGL03242:Olfr710 APN 7 106944918 missense possibly damaging 0.59
R1985:Olfr710 UTSW 7 106944926 missense probably benign 0.00
R2234:Olfr710 UTSW 7 106944620 missense probably damaging 1.00
R3414:Olfr710 UTSW 7 106944176 nonsense probably null
R3731:Olfr710 UTSW 7 106944477 missense probably damaging 0.99
R3777:Olfr710 UTSW 7 106944312 missense probably benign 0.05
R4646:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4647:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4661:Olfr710 UTSW 7 106944867 missense probably damaging 0.98
R4679:Olfr710 UTSW 7 106944945 missense probably benign 0.10
R5495:Olfr710 UTSW 7 106944492 nonsense probably null
R6744:Olfr710 UTSW 7 106944534 missense probably damaging 1.00
R6908:Olfr710 UTSW 7 106944632 missense possibly damaging 0.82
R7463:Olfr710 UTSW 7 106944173 missense probably damaging 0.99
R7498:Olfr710 UTSW 7 106944368 missense possibly damaging 0.93
RF003:Olfr710 UTSW 7 106944648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGACTAGCATCTTTGGAAC -3'
(R):5'- GCACATACCAATCAGCTTTAGG -3'

Sequencing Primer
(F):5'- TGTTGTAGAGAAACAGAGATCATTG -3'
(R):5'- GCTTTAGGAGCCATATAGCTATACAG -3'
Posted On2016-07-06