Incidental Mutation 'R5200:Tmem38a'
ID400696
Institutional Source Beutler Lab
Gene Symbol Tmem38a
Ensembl Gene ENSMUSG00000031791
Gene Nametransmembrane protein 38A
Synonyms1110001E17Rik, TRIC-A
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72572055-72587282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72580034 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 119 (V119E)
Ref Sequence ENSEMBL: ENSMUSP00000148388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034244] [ENSMUST00000211914] [ENSMUST00000212763]
Predicted Effect probably damaging
Transcript: ENSMUST00000034244
AA Change: V119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034244
Gene: ENSMUSG00000031791
AA Change: V119E

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TRIC 40 231 5.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211914
Predicted Effect probably damaging
Transcript: ENSMUST00000212763
AA Change: V119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Tmem38a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Tmem38a APN 8 72579974 missense probably damaging 0.99
IGL02715:Tmem38a APN 8 72579668 missense possibly damaging 0.69
IGL02967:Tmem38a APN 8 72586082 missense possibly damaging 0.95
R0631:Tmem38a UTSW 8 72580018 missense probably benign 0.05
R1073:Tmem38a UTSW 8 72580103 missense probably damaging 1.00
R1161:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1310:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1489:Tmem38a UTSW 8 72579635 missense probably damaging 1.00
R2040:Tmem38a UTSW 8 72581252 missense probably damaging 1.00
R4508:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4515:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4517:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4521:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4522:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4529:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4867:Tmem38a UTSW 8 72581233 missense possibly damaging 0.80
R5807:Tmem38a UTSW 8 72580100 missense probably damaging 1.00
R5882:Tmem38a UTSW 8 72585887 missense probably damaging 1.00
R7803:Tmem38a UTSW 8 72572120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAACCAGTGGACACCCTTC -3'
(R):5'- TACCTTGTGGGAGTGAATGC -3'

Sequencing Primer
(F):5'- AGTGGACACCCTTCCCCTG -3'
(R):5'- CCAAGTTTTGGCTGCAAGC -3'
Posted On2016-07-06