Incidental Mutation 'R5200:Zfp612'
ID400699
Institutional Source Beutler Lab
Gene Symbol Zfp612
Ensembl Gene ENSMUSG00000044676
Gene Namezinc finger protein 612
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110079746-110092741 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 110089900 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 580 (Q580*)
Ref Sequence ENSEMBL: ENSMUSP00000148717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058804] [ENSMUST00000165700] [ENSMUST00000212754]
Predicted Effect probably null
Transcript: ENSMUST00000058804
AA Change: Q541*
SMART Domains Protein: ENSMUSP00000062474
Gene: ENSMUSG00000044676
AA Change: Q541*

DomainStartEndE-ValueType
KRAB 11 71 2e-32 SMART
low complexity region 135 146 N/A INTRINSIC
ZnF_C2H2 225 247 1.45e-2 SMART
ZnF_C2H2 253 275 2.67e-1 SMART
ZnF_C2H2 281 303 1.4e-4 SMART
ZnF_C2H2 309 331 2.91e-2 SMART
ZnF_C2H2 337 359 3.16e-3 SMART
ZnF_C2H2 365 387 4.17e-3 SMART
ZnF_C2H2 393 415 1.82e-3 SMART
ZnF_C2H2 421 443 3.69e-4 SMART
ZnF_C2H2 449 471 3.69e-4 SMART
ZnF_C2H2 477 499 1.58e-3 SMART
ZnF_C2H2 505 527 4.87e-4 SMART
ZnF_C2H2 533 555 1.38e-3 SMART
ZnF_C2H2 561 583 5.06e-2 SMART
ZnF_C2H2 589 611 5.9e-3 SMART
ZnF_C2H2 617 639 9.44e-2 SMART
ZnF_C2H2 645 667 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165700
Predicted Effect probably null
Transcript: ENSMUST00000212754
AA Change: Q580*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Other mutations in Zfp612
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Zfp612 UTSW 8 110090038 missense probably damaging 1.00
R1920:Zfp612 UTSW 8 110088463 missense probably benign 0.03
R2994:Zfp612 UTSW 8 110089417 missense probably damaging 1.00
R4281:Zfp612 UTSW 8 110090059 missense probably damaging 0.98
R4378:Zfp612 UTSW 8 110089051 missense possibly damaging 0.92
R4492:Zfp612 UTSW 8 110089297 missense probably damaging 0.99
R4748:Zfp612 UTSW 8 110088672 missense probably benign 0.37
R4890:Zfp612 UTSW 8 110089944 nonsense probably null
R5443:Zfp612 UTSW 8 110089595 missense possibly damaging 0.85
R5864:Zfp612 UTSW 8 110089726 missense probably damaging 1.00
R6177:Zfp612 UTSW 8 110089974 missense probably damaging 1.00
R6435:Zfp612 UTSW 8 110089320 missense probably damaging 0.99
R6601:Zfp612 UTSW 8 110089549 missense possibly damaging 0.92
R7082:Zfp612 UTSW 8 110089705 missense probably damaging 1.00
R7083:Zfp612 UTSW 8 110089136 missense probably damaging 1.00
RF007:Zfp612 UTSW 8 110089542 nonsense probably null
RF008:Zfp612 UTSW 8 110089561 missense probably damaging 1.00
Z1176:Zfp612 UTSW 8 110088863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACCTGCTGGATCACC -3'
(R):5'- CTTAGTTGGAAGCTAAACCTGAAAG -3'

Sequencing Primer
(F):5'- TGGATCACCAGCGAGCC -3'
(R):5'- GGAAGCTAAACCTGAAAGTTTTCCC -3'
Posted On2016-07-06