Incidental Mutation 'R5200:Dyx1c1'
ID400703
Institutional Source Beutler Lab
Gene Symbol Dyx1c1
Ensembl Gene ENSMUSG00000092192
Gene Namedyslexia susceptibility 1 candidate 1
Synonyms1700010I24Rik, b2b811Clo, EKN1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R5200 (G1)
Quality Score156
Status Not validated
Chromosome9
Chromosomal Location72958785-72973064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72972431 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 418 (S418P)
Ref Sequence ENSEMBL: ENSMUSP00000034734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034734] [ENSMUST00000098567] [ENSMUST00000149692]
Predicted Effect probably damaging
Transcript: ENSMUST00000034734
AA Change: S418P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034734
Gene: ENSMUSG00000092192
AA Change: S418P

DomainStartEndE-ValueType
Pfam:CS 6 77 5.8e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
TPR 288 321 2.56e1 SMART
TPR 322 355 1.26e-1 SMART
TPR 364 397 2.59e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098567
AA Change: S298P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096166
Gene: ENSMUSG00000092192
AA Change: S298P

DomainStartEndE-ValueType
Pfam:CS 6 77 1.3e-14 PFAM
TPR 168 201 2.56e1 SMART
TPR 202 235 1.26e-1 SMART
TPR 244 277 2.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193501
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit both pre- and postnatal lethality, hydrocephalus, and defects in organ laterality and ciliary motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Dyx1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dyx1c1 APN 9 72969066 missense probably benign 0.02
R0211:Dyx1c1 UTSW 9 72961367 missense possibly damaging 0.82
R0310:Dyx1c1 UTSW 9 72972336 missense probably damaging 1.00
R0712:Dyx1c1 UTSW 9 72960657 nonsense probably null
R1791:Dyx1c1 UTSW 9 72960684 missense possibly damaging 0.90
R1927:Dyx1c1 UTSW 9 72960627 missense probably damaging 0.98
R3085:Dyx1c1 UTSW 9 72972406 missense probably benign 0.00
R4624:Dyx1c1 UTSW 9 72964171 missense probably benign 0.01
R4998:Dyx1c1 UTSW 9 72960678 missense possibly damaging 0.93
R5008:Dyx1c1 UTSW 9 72972318 intron probably benign
R5256:Dyx1c1 UTSW 9 72972080 critical splice donor site probably null
R5806:Dyx1c1 UTSW 9 72962054 missense probably benign 0.06
R5930:Dyx1c1 UTSW 9 72971998 missense probably damaging 1.00
R6751:Dyx1c1 UTSW 9 72961975 missense probably benign 0.08
Z1177:Dyx1c1 UTSW 9 72961964 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGGAGACCCTGTTTCAGAAAGAC -3'
(R):5'- GAGGACTCAAACAGCCTGTTCTC -3'

Sequencing Primer
(F):5'- CCCTGTTTCAGAAAGACAAAAAGTTG -3'
(R):5'- TGGCCTCAAGCTCATAGAGACTTG -3'
Posted On2016-07-06