Incidental Mutation 'R5200:Myo6'
ID400705
Institutional Source Beutler Lab
Gene Symbol Myo6
Ensembl Gene ENSMUSG00000033577
Gene Namemyosin VI
SynonymsTlc
Accession Numbers

MGI:104785

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location80165031-80311729 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 80276374 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 684 (Q684*)
Ref Sequence ENSEMBL: ENSMUSP00000139019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000113266] [ENSMUST00000113268] [ENSMUST00000127779] [ENSMUST00000184480]
Predicted Effect probably null
Transcript: ENSMUST00000035889
AA Change: Q684*
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577
AA Change: Q684*

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably null
Transcript: ENSMUST00000076140
AA Change: Q684*
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577
AA Change: Q684*

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably null
Transcript: ENSMUST00000113266
AA Change: Q684*
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577
AA Change: Q684*

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect probably null
Transcript: ENSMUST00000113268
AA Change: Q684*
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577
AA Change: Q684*

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127779
AA Change: Q684*
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577
AA Change: Q684*

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect probably null
Transcript: ENSMUST00000184480
AA Change: Q684*
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577
AA Change: Q684*

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Myo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
torticollis UTSW 9 80288217 critical splice donor site probably null
truths UTSW 9 80270039 nonsense probably null
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0791:Myo6 UTSW 9 80262374 splice site probably benign
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R1978:Myo6 UTSW 9 80228925 missense probably damaging 0.99
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2092:Myo6 UTSW 9 80245682 missense probably damaging 1.00
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 intron probably null
R2898:Myo6 UTSW 9 80269611 intron probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R6693:Myo6 UTSW 9 80245731 missense probably damaging 1.00
R7151:Myo6 UTSW 9 80245136 missense unknown
R7399:Myo6 UTSW 9 80262291 missense unknown
R7492:Myo6 UTSW 9 80288046 nonsense probably null
R7651:Myo6 UTSW 9 80264266 critical splice donor site probably null
R7698:Myo6 UTSW 9 80217656 missense unknown
R7743:Myo6 UTSW 9 80276329 missense unknown
R7888:Myo6 UTSW 9 80296665 missense probably damaging 0.99
R7971:Myo6 UTSW 9 80296665 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGGTTAGACATGCAGAGTGC -3'
(R):5'- GTCAGTGTTTCTCAGGTCACC -3'

Sequencing Primer
(F):5'- GACATGCAGAGTGCTTTGTTTAAATG -3'
(R):5'- CTGGCCCCTGTGCTTTATTCAAC -3'
Posted On2016-07-06