Incidental Mutation 'R5240:Prkd2'
ID400719
Institutional Source Beutler Lab
Gene Symbol Prkd2
Ensembl Gene ENSMUSG00000041187
Gene Nameprotein kinase D2
SynonymsPKD2
MMRRC Submission 042811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16842902-16870464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16855786 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 471 (I471N)
Ref Sequence ENSEMBL: ENSMUSP00000131192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086104] [ENSMUST00000168093]
Predicted Effect probably benign
Transcript: ENSMUST00000086104
AA Change: I471N

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083273
Gene: ENSMUSG00000041187
AA Change: I471N

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168093
AA Change: I471N

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131192
Gene: ENSMUSG00000041187
AA Change: I471N

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205456
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired IgM and IgG1 antigen responses and CD4+ and CD8+ T cell production of IL2 and IFN-gamma in response to TCR stimulation. Mice homozygous for a gene trap allele exhibit normal T lymphocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp619 A G 7: 39,537,218 T891A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Prkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Prkd2 APN 7 16865862 missense probably damaging 1.00
IGL01138:Prkd2 APN 7 16848811 missense probably damaging 1.00
IGL01714:Prkd2 APN 7 16863942 missense probably damaging 1.00
IGL01968:Prkd2 APN 7 16869576 splice site probably null
IGL01969:Prkd2 APN 7 16865757 missense probably damaging 1.00
IGL02354:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02361:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02504:Prkd2 APN 7 16857832 missense probably damaging 1.00
IGL02804:Prkd2 APN 7 16855890 missense probably benign 0.04
IGL02834:Prkd2 APN 7 16845934 missense probably damaging 0.97
IGL02962:Prkd2 APN 7 16869832 missense probably benign 0.01
IGL03053:Prkd2 APN 7 16850263 missense possibly damaging 0.63
IGL03168:Prkd2 APN 7 16850263 missense possibly damaging 0.63
alila UTSW 7 16847654 missense probably damaging 1.00
Beaches UTSW 7 16849203 nonsense probably null
Purnama UTSW 7 16869565 missense probably damaging 1.00
Sandals UTSW 7 16865714 missense probably damaging 1.00
R0024:Prkd2 UTSW 7 16847643 missense probably damaging 1.00
R0173:Prkd2 UTSW 7 16849044 missense probably benign
R0190:Prkd2 UTSW 7 16869890 missense probably damaging 1.00
R0834:Prkd2 UTSW 7 16865677 splice site probably benign
R1418:Prkd2 UTSW 7 16869545 missense probably benign 0.03
R1488:Prkd2 UTSW 7 16858439 missense probably damaging 1.00
R1648:Prkd2 UTSW 7 16857807 missense possibly damaging 0.51
R2015:Prkd2 UTSW 7 16847677 nonsense probably null
R2042:Prkd2 UTSW 7 16856268 missense possibly damaging 0.86
R2101:Prkd2 UTSW 7 16869565 missense probably damaging 1.00
R3884:Prkd2 UTSW 7 16853255 missense probably benign 0.02
R4601:Prkd2 UTSW 7 16843648 unclassified probably benign
R4979:Prkd2 UTSW 7 16848727 missense probably damaging 1.00
R5643:Prkd2 UTSW 7 16843792 missense probably benign 0.02
R5994:Prkd2 UTSW 7 16850336 missense probably benign 0.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6361:Prkd2 UTSW 7 16847654 missense probably damaging 1.00
R6738:Prkd2 UTSW 7 16865905 missense possibly damaging 0.64
R6798:Prkd2 UTSW 7 16849203 nonsense probably null
R6815:Prkd2 UTSW 7 16843793 missense probably benign 0.00
R7241:Prkd2 UTSW 7 16857805 missense probably benign 0.44
R7293:Prkd2 UTSW 7 16845940 missense possibly damaging 0.88
R7323:Prkd2 UTSW 7 16847622 missense probably benign 0.07
R7900:Prkd2 UTSW 7 16853344 missense probably benign 0.01
R7983:Prkd2 UTSW 7 16853344 missense probably benign 0.01
X0062:Prkd2 UTSW 7 16855791 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCATGGTTAGCATGGGTACG -3'
(R):5'- AGGTAGGGACTTACTGTGCG -3'

Sequencing Primer
(F):5'- GTAGACCAGGTCTGTCCTTATTGAC -3'
(R):5'- TACTGTGCGGTGTGTGCCC -3'
Posted On2016-07-06