Incidental Mutation 'R5240:Zfp619'
ID400721
Institutional Source Beutler Lab
Gene Symbol Zfp619
Ensembl Gene ENSMUSG00000068959
Gene Namezinc finger protein 619
Synonyms3000002G13Rik
MMRRC Submission 042811-MU
Accession Numbers

Genbank: NM_001004139; MGI: 1917477

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5240 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location39517766-39540420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39537218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 891 (T891A)
Ref Sequence ENSEMBL: ENSMUSP00000103650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108015]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108015
AA Change: T891A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103650
Gene: ENSMUSG00000068959
AA Change: T891A

DomainStartEndE-ValueType
KRAB 4 61 2.19e-20 SMART
ZnF_C2H2 218 240 2.91e-2 SMART
ZnF_C2H2 246 268 5.81e-2 SMART
ZnF_C2H2 274 296 3.16e-3 SMART
ZnF_C2H2 302 324 2.4e-3 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 380 6.32e-3 SMART
ZnF_C2H2 386 408 8.47e-4 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 1.58e-3 SMART
ZnF_C2H2 470 492 5.42e-2 SMART
ZnF_C2H2 526 548 2.09e-3 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
ZnF_C2H2 582 604 1.56e-2 SMART
ZnF_C2H2 610 632 2.24e-3 SMART
ZnF_C2H2 638 660 4.72e-2 SMART
ZnF_C2H2 666 688 7.78e-3 SMART
ZnF_C2H2 694 716 5.9e-3 SMART
ZnF_C2H2 722 744 1.12e-3 SMART
ZnF_C2H2 748 770 6.42e-4 SMART
ZnF_C2H2 776 798 1.38e-3 SMART
ZnF_C2H2 804 826 9.44e-2 SMART
ZnF_C2H2 832 854 2.36e-2 SMART
ZnF_C2H2 860 882 8.94e-3 SMART
ZnF_C2H2 888 910 3.58e-2 SMART
ZnF_C2H2 916 938 6.42e-4 SMART
ZnF_C2H2 942 964 4.72e-2 SMART
ZnF_C2H2 970 992 2.3e-5 SMART
ZnF_C2H2 998 1020 8.34e-3 SMART
ZnF_C2H2 1026 1048 8.81e-2 SMART
ZnF_C2H2 1054 1076 1.69e-3 SMART
ZnF_C2H2 1082 1104 6.32e-3 SMART
ZnF_C2H2 1110 1132 1.47e-3 SMART
ZnF_C2H2 1138 1160 7.15e-2 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), such as ZNF208, bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates protein-protein interactions (Eichler et al., 1998 [PubMed 9724325]). See ZNF91 (MIM 603971) for further information on ZNFs.[supplied by OMIM, Aug 2009]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T G 19: 6,315,899 L786R probably damaging Het
Cfap73 C T 5: 120,629,707 V260I probably damaging Het
Chchd10 A T 10: 75,937,449 N131I probably damaging Het
Chn2 T C 6: 54,220,695 V190A probably benign Het
Clec2l C T 6: 38,673,452 T64I probably damaging Het
Cpeb3 T A 19: 37,174,515 T154S probably damaging Het
D130043K22Rik A G 13: 24,877,977 E643G probably damaging Het
Ddx31 A G 2: 28,846,030 M127V probably benign Het
Dennd1b A G 1: 139,062,877 Y193C probably damaging Het
Dgke T A 11: 89,050,685 D288V probably damaging Het
Dst T A 1: 34,208,558 L1683* probably null Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
E130116L18Rik G T 5: 25,223,020 probably benign Het
Eif2b5 G A 16: 20,501,398 V115I possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fgfr3 A T 5: 33,730,038 T234S probably damaging Het
Gipc2 A T 3: 152,102,662 D251E possibly damaging Het
Gm11787 A C 4: 3,511,810 noncoding transcript Het
Gm5538 A C 3: 59,752,028 T301P probably damaging Het
Haus6 A G 4: 86,583,178 Y819H possibly damaging Het
Homez G A 14: 54,858,074 A59V probably damaging Het
Iffo1 T C 6: 125,152,460 V363A probably benign Het
Ifit2 T A 19: 34,574,396 D445E probably benign Het
Ipo9 A C 1: 135,389,606 probably benign Het
Kcnv1 C T 15: 45,113,244 G216R probably damaging Het
Kdm6b A C 11: 69,401,904 probably benign Het
Mplkip T C 13: 17,695,719 S79P probably damaging Het
Nae1 T C 8: 104,523,144 probably benign Het
Nfe2l2 A T 2: 75,676,009 N582K possibly damaging Het
Nsmce4a G A 7: 130,537,024 R297C probably damaging Het
Olfr397 T C 11: 73,964,806 L66P probably damaging Het
Olfr411 T A 11: 74,347,242 D114V probably damaging Het
Olfr495 A T 7: 108,395,702 D194V probably damaging Het
Osbp T A 19: 11,978,290 F357I probably damaging Het
Pcdhb4 A G 18: 37,309,926 D763G possibly damaging Het
Pcdhgb2 A C 18: 37,691,050 I365L possibly damaging Het
Pde6g A G 11: 120,448,086 probably benign Het
Pigo C A 4: 43,020,675 V756L possibly damaging Het
Pkhd1 G T 1: 20,275,641 T2721K probably benign Het
Pls1 A T 9: 95,776,622 probably null Het
Prim2 A G 1: 33,480,316 probably benign Het
Prkd2 T A 7: 16,855,786 I471N probably benign Het
Prrc2b C T 2: 32,206,396 T593I probably benign Het
Ptch2 C A 4: 117,106,138 probably benign Het
Pth A T 7: 113,385,844 D107E probably damaging Het
Pycr2 A C 1: 180,907,623 Q315P probably benign Het
Rbpj A T 5: 53,649,440 Y209F probably damaging Het
Ripk4 C A 16: 97,743,767 R560L probably damaging Het
Sdr42e1 T C 8: 117,663,282 R207G probably benign Het
Sipa1l1 A G 12: 82,341,588 Y196C possibly damaging Het
Smarcc2 T C 10: 128,481,006 probably null Het
Stom T A 2: 35,336,877 I15F probably benign Het
Sugp2 G T 8: 70,243,275 L299F probably benign Het
Tbrg4 A T 11: 6,617,516 probably null Het
Tkt G T 14: 30,565,678 G210C probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Trip12 A G 1: 84,794,133 I98T probably benign Het
Unc5b A G 10: 60,774,640 I466T probably damaging Het
Unc79 T A 12: 103,070,751 F599L probably damaging Het
Vav1 G A 17: 57,297,122 E151K probably damaging Het
Vcan T G 13: 89,692,532 D1631A probably benign Het
Vmn2r4 A C 3: 64,406,937 S208A possibly damaging Het
Zfp672 A G 11: 58,329,701 probably benign Het
Znhit1 T A 5: 136,982,381 probably null Het
Other mutations in Zfp619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zfp619 APN 7 39534864 missense probably damaging 1.00
IGL02221:Zfp619 APN 7 39536910 missense probably benign 0.00
IGL02625:Zfp619 APN 7 39534185 splice site probably benign
3-1:Zfp619 UTSW 7 39536765 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0113:Zfp619 UTSW 7 39537759 missense probably benign 0.01
R0377:Zfp619 UTSW 7 39536797 nonsense probably null
R0614:Zfp619 UTSW 7 39537675 missense possibly damaging 0.79
R0848:Zfp619 UTSW 7 39536559 missense probably damaging 1.00
R1157:Zfp619 UTSW 7 39536858 missense probably damaging 0.98
R2047:Zfp619 UTSW 7 39537638 missense probably damaging 0.99
R2074:Zfp619 UTSW 7 39534761 missense probably benign 0.00
R2419:Zfp619 UTSW 7 39535883 missense possibly damaging 0.71
R2571:Zfp619 UTSW 7 39537171 missense probably damaging 1.00
R2890:Zfp619 UTSW 7 39534969 missense probably benign 0.00
R3814:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4003:Zfp619 UTSW 7 39537306 missense possibly damaging 0.91
R4059:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4503:Zfp619 UTSW 7 39536856 missense probably damaging 1.00
R4664:Zfp619 UTSW 7 39534135 missense probably benign 0.00
R4696:Zfp619 UTSW 7 39536988 missense probably benign 0.00
R4895:Zfp619 UTSW 7 39537972 missense possibly damaging 0.68
R4975:Zfp619 UTSW 7 39537080 missense possibly damaging 0.90
R4977:Zfp619 UTSW 7 39537387 missense probably damaging 1.00
R5049:Zfp619 UTSW 7 39535514 missense probably benign 0.02
R5468:Zfp619 UTSW 7 39535728 missense unknown
R5546:Zfp619 UTSW 7 39535153 missense probably benign 0.01
R5572:Zfp619 UTSW 7 39535239 missense probably benign 0.01
R6106:Zfp619 UTSW 7 39535134 missense probably benign 0.01
R6329:Zfp619 UTSW 7 39537545 missense probably damaging 1.00
R6354:Zfp619 UTSW 7 39534819 missense probably benign 0.02
R6395:Zfp619 UTSW 7 39537030 missense possibly damaging 0.91
R6490:Zfp619 UTSW 7 39534162 missense probably benign 0.00
R6560:Zfp619 UTSW 7 39537530 missense probably damaging 1.00
R6713:Zfp619 UTSW 7 39537898 missense probably damaging 0.99
R7011:Zfp619 UTSW 7 39537762 missense probably damaging 1.00
R7022:Zfp619 UTSW 7 39534963 missense probably benign 0.00
R7046:Zfp619 UTSW 7 39537363 missense possibly damaging 0.95
R7206:Zfp619 UTSW 7 39535400 missense probably benign 0.00
R7780:Zfp619 UTSW 7 39535008 missense possibly damaging 0.68
R7787:Zfp619 UTSW 7 39536802 missense possibly damaging 0.91
R8001:Zfp619 UTSW 7 39535221 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GCAATGCGCTAAGTCCTTC -3'
(R):5'- AAGGACTTCCCACACTGCT -3'

Sequencing Primer
(F):5'- TGCAGAAAAGCCCTATAAATGCATG -3'
(R):5'- GGAACTCTGACTTCTGAAGGC -3'
Posted On2016-07-06